Ziee Z

25 Februari 2024 15:12

Iklan

Iklan

Ziee Z

25 Februari 2024 15:12

Pertanyaan

Bacalah teks berikut! (1) Pada 17 Agustus 1945, tak lama setelah Jepang takluk kepada Sekutu, atas desakan para aktivis pemuda yang menculik Soekarno ke Rengasdengklok, Soekarno dan Hatta memproklamasikan kemerdekaan Indonesia. (2) Sehari kemudian Soekarno-Hatta diangkat menjadi presiden dan wakil presiden pertama Indonesia. (3) Pada masa itu Soekarno-Hatta pernah dibuang kembali ke Parapat dan Bangka. (4) Mereka segera terlibat dalam perjuangan melawan pendudukan kembali oleh Belanda. (5) Namun, ketika secara resmi Belanda mengakui kedaulatan Indonesia pada 1949, kedudukan Soekarno sebagai presiden dipulihkan. Urutan kalimat-kalimat tersebut agar menjadi teks biografi yang baik adalah a. (1), (4), (2), (3), (5) b. (1), (2), (3), (4), (5) C. (1), (2), (4), (3), (5) d. (1), (5), (4), (3), (2) e. (1), (4), (3), (2), (5)


320

1


Iklan

Iklan

Yuni H

26 Februari 2024 13:33

<h1>b. (1), (2), (3), (4), (5)</h1>

b. (1), (2), (3), (4), (5)


Iklan

Iklan

Mau jawaban yang terverifikasi?

Tanya ke Forum

Biar Robosquad lain yang jawab soal kamu

Tanya ke Forum

LATIHAN SOAL GRATIS!

Drill Soal

Latihan soal sesuai topik yang kamu mau untuk persiapan ujian

Cobain Drill Soal

Perdalam pemahamanmu bersama Master Teacher
di sesi Live Teaching, GRATIS!

Pertanyaan serupa

1. Jelaskanpenggunaam metode metagenom dapat dimanfaatkan untuk menemukan produk-produk bioteknologi yang bermanfaat pada bidang farmasi. Uraikan jawaban anda dengan menjelaskan definisi, contoh produk dan teknik pembuatan produk 2. Pemerintah Indonesia menggunakan 3 metode untuk mendeteksi keberadaan SARS-cov2,yaitu tes cepat antibodi, tes cepat molekuler, dan real time PCR. a.Jelaskan perbedaan prinsip kerja ketiga cara tersebut! b.Jelaskan tahap-tahap real time PCR, gen target, urutan primer yang digunakan, siklusamplifikasi. Tuliskan sumber referensi yang anda gunakan 3. Sebutkan urutan asam amino hasil translasi yang dikode oleh “DNA templat” berikut ini:3’ atttacgatagtttcgatagacaaaagtcaattcgtttcgaattatcaattgccgcatcactt 5’ 4.Berikan salah satu jurnal penelitian pembuatan DNA rekombinan pada bidang farmasi,kemudian: a.Gambarkan plasmid yang digunakan sebagai vektor pembuatan DNA rekombinan! b.Jelaskan arti dan fungsi setiap notasi dalam gambar!

2

0.0

Jawaban terverifikasi

1.Berikut ini merupakan salah satu wujud program CSR, kecuali a. pemberian subsidi b. pemberian beasiswa C. dana untuk pemeliharaan fasilitas umum d. sumbangan untuk fasilitas umum 2.Suatu konsep yang dilakukan perusahaan sebagai rasa tanggung jawab perusahaan terhadap sosial maupun, lingkungan sekitar perusahaan disebut... a. Company Social Responsibility b. Corporate Social Responsibility c. Company Social Responsible d. Corporate Social Responsible 3.Tokoh dari Belanda yang menerapkan sistem pemerintahan modern yang terkenal dengan sistem perpajakannya adalah a. Daendels C. Van Mook b. Raffles d. M.J. Mose 4.Tokoh yang mendirikan sekolah kebangsaan Taman Siswa adalah... a.Moh. Syafei b. Budi Utomo C Wahidin Sudirohusodo d. Ki Hajar Dewantara 5.Berikut faktor-faktor yang menyebabkan Indonesia menjadi penting bagi perdagangan dan pelayaran antara Asia dan Eropa, kecuali .... a. kondisi geografis b. kepadatan penduduk C. faktor keamanan d. penghasil rempah-rempah 6.Untuk mengatasi kas Belanda yang kosong, maka Belanda menerapkan strategi..... a. monopoli perdagangan b. pelayaran hongi c. pembentukan VOC d. Culture Stelsel 7.Salah satu program pemerintah pemberian jaminan akses kebutuhan dasar bagi rakyat bawah, kecuali .... a. Bantuan Langsung Tunai (BLT) b. Bantuan Tunai Bersyarat (BTB) c. Program Keluarga Harapan (PKH) d. Kredit Usaha Rakyat (KUR) 8.Berikut ini yang bukan merupakan aturan tanam paksa adalah .... a. petani harus menyediakan seperempat dari tanahnya untuk ditanami tanaman wajib b. tanah yang ditanami tanaman wajib merupakan tanah bebas pajak C. hasil tanaman harus dijual kepada Belanda dengan harga yang sudah ditentukan d. waktu tanam tidak boleh melebihi waktu menanam padi 9. Raja Kerajaan Banten yang bersahabat dengan VOC dan menjalin kerja sama adalah .... a. Sultan Ageng Tirtayasa b. Sultan Iskandar Muda C. Sultan Haji d. Sultan Hairun

17

5.0

Jawaban terverifikasi