Khayla Y

15 Maret 2024 07:38



Khayla Y

15 Maret 2024 07:38






Jawaban terverifikasi



Nia A

15 Maret 2024 16:04

Jawaban terverifikasi

<p>Diket:</p><p>12% - 4/5 × 23</p><p>Dit:</p><p>Hasilnya ... ?</p><p>Jwb:</p><p>= 12% (- 4/5 × 23)</p><p>= 12% - (23 × 4)/5</p><p>= (12/100) - (92/5)</p><p>= (12/100) - ((92×20)/(5×20))</p><p>= (12/100) - (1840/100)</p><p>= (12 - 1840)/100</p><p>= (-1828)/100</p><p>= -18,28</p>


12% - 4/5 × 23


Hasilnya ... ?


= 12% (- 4/5 × 23)

= 12% - (23 × 4)/5

= (12/100) - (92/5)

= (12/100) - ((92×20)/(5×20))

= (12/100) - (1840/100)

= (12 - 1840)/100

= (-1828)/100

= -18,28



Sunnie S

15 Maret 2024 14:50

<p>Jawaban : -18, 28</p><p>&nbsp;</p>

Jawaban : -18, 28



Yah, akses pembahasan gratismu habis


Dapatkan jawaban pertanyaanmu di AiRIS. Langsung dijawab oleh bestie pintar

Tanya Sekarang

Mau pemahaman lebih dalam untuk soal ini?

Tanya ke Forum

Biar Robosquad lain yang jawab soal kamu

Tanya ke Forum

Roboguru Plus

Dapatkan pembahasan soal ga pake lama, langsung dari Tutor!

Chat Tutor

Perdalam pemahamanmu bersama Master Teacher
di sesi Live Teaching, GRATIS!

Pertanyaan serupa

1. Jelaskanpenggunaam metode metagenom dapat dimanfaatkan untuk menemukan produk-produk bioteknologi yang bermanfaat pada bidang farmasi. Uraikan jawaban anda dengan menjelaskan definisi, contoh produk dan teknik pembuatan produk 2. Pemerintah Indonesia menggunakan 3 metode untuk mendeteksi keberadaan SARS-cov2,yaitu tes cepat antibodi, tes cepat molekuler, dan real time PCR. a.Jelaskan perbedaan prinsip kerja ketiga cara tersebut! b.Jelaskan tahap-tahap real time PCR, gen target, urutan primer yang digunakan, siklusamplifikasi. Tuliskan sumber referensi yang anda gunakan 3. Sebutkan urutan asam amino hasil translasi yang dikode oleh “DNA templat” berikut ini:3’ atttacgatagtttcgatagacaaaagtcaattcgtttcgaattatcaattgccgcatcactt 5’ 4.Berikan salah satu jurnal penelitian pembuatan DNA rekombinan pada bidang farmasi,kemudian: a.Gambarkan plasmid yang digunakan sebagai vektor pembuatan DNA rekombinan! b.Jelaskan arti dan fungsi setiap notasi dalam gambar!



Jawaban terverifikasi