Kinara R

26 Maret 2024 00:34

Iklan

Iklan

Kinara R

26 Maret 2024 00:34

Pertanyaan

pada pohon, terdapat 2 tipe lingkaran tahun: musim kemarau dan musim penghujan. lalu bagaimana dengan lingkaran tahun pohon yang di mana mereka hidup di negara 4 musim?

pada pohon, terdapat 2 tipe lingkaran tahun: musim kemarau dan musim penghujan. lalu bagaimana dengan lingkaran tahun pohon yang di mana mereka hidup di negara 4 musim?


16

2

Jawaban terverifikasi

Iklan

Iklan

Rich. R

27 Maret 2024 08:05

Jawaban terverifikasi

<p>Lingkaran tahun pada pohon adalah cincin yang terbentuk setiap tahun yang menunjukkan pertumbuhan pohon selama periode tersebut. Di daerah dengan dua musim, yaitu musim kemarau dan musim penghujan, pohon akan menunjukkan dua cincin pertumbuhan yang berbeda: satu untuk musim kemarau dan satu untuk musim penghujan. Namun, di negara dengan empat musim, pohon akan menunjukkan empat cincin pertumbuhan yang berbeda, masing-masing untuk musim semi, musim panas, musim gugur, dan musim dingin. Setiap musim memiliki kondisi pertumbuhan yang berbeda, seperti suhu dan kelembaban, yang akan mempengaruhi kecepatan pertumbuhan pohon. Oleh karena itu, lingkaran tahun pada pohon dapat memberikan informasi tentang kondisi iklim dan lingkungan di mana pohon tersebut tumbuh selama bertahun-tahun.</p>

Lingkaran tahun pada pohon adalah cincin yang terbentuk setiap tahun yang menunjukkan pertumbuhan pohon selama periode tersebut. Di daerah dengan dua musim, yaitu musim kemarau dan musim penghujan, pohon akan menunjukkan dua cincin pertumbuhan yang berbeda: satu untuk musim kemarau dan satu untuk musim penghujan. Namun, di negara dengan empat musim, pohon akan menunjukkan empat cincin pertumbuhan yang berbeda, masing-masing untuk musim semi, musim panas, musim gugur, dan musim dingin. Setiap musim memiliki kondisi pertumbuhan yang berbeda, seperti suhu dan kelembaban, yang akan mempengaruhi kecepatan pertumbuhan pohon. Oleh karena itu, lingkaran tahun pada pohon dapat memberikan informasi tentang kondisi iklim dan lingkungan di mana pohon tersebut tumbuh selama bertahun-tahun.


Iklan

Iklan

Daniel N

26 Maret 2024 06:42

Jawaban terverifikasi

<p>Pada pohon yang hidup di negara 4 musim, terdapat 2 tipe lingkaran tahun: musim hujan dan musim kemarau. Musim hujan adalah periode ketika terjadi peningkatan curah hujan di suatu wilayah, biasanya terjadi pada bulan Oktober hingga bulan Maret</p><p>&nbsp;</p><p>Musim kemarau adalah periode ketika terjadi penurunan curah hujan di suatu wilayah, biasanya terjadi pada bulan April hingga bulan September</p><p>&nbsp;</p><p>.Pada Indonesia, negara yang memiliki dua jenis musim dalam setahun, yaitu musim hujan dan musim kemarau</p><p>&nbsp;</p><p>. Musim kemarau ditandai oleh berkurangnya hari hujan dan rendahnya jumlah curah hujan yang terukur di permukaan</p><p>&nbsp;</p><p>. Musim hujan di Indonesia terjadi pada bulan Oktober hingga bulan Maret, sementara musim kemarau terjadi pada bulan April hingga bulan September</p><p>&nbsp;</p><p>&nbsp;</p><p>&nbsp;</p><p>&nbsp;</p><p><br>&nbsp;</p>

Pada pohon yang hidup di negara 4 musim, terdapat 2 tipe lingkaran tahun: musim hujan dan musim kemarau. Musim hujan adalah periode ketika terjadi peningkatan curah hujan di suatu wilayah, biasanya terjadi pada bulan Oktober hingga bulan Maret

 

Musim kemarau adalah periode ketika terjadi penurunan curah hujan di suatu wilayah, biasanya terjadi pada bulan April hingga bulan September

 

.Pada Indonesia, negara yang memiliki dua jenis musim dalam setahun, yaitu musim hujan dan musim kemarau

 

. Musim kemarau ditandai oleh berkurangnya hari hujan dan rendahnya jumlah curah hujan yang terukur di permukaan

 

. Musim hujan di Indonesia terjadi pada bulan Oktober hingga bulan Maret, sementara musim kemarau terjadi pada bulan April hingga bulan September

 

 

 

 


 


lock

Yah, akses pembahasan gratismu habis


atau

Dapatkan jawaban pertanyaanmu di AiRIS. Langsung dijawab oleh bestie pintar

Tanya Sekarang

Mau pemahaman lebih dalam untuk soal ini?

Tanya ke Forum

Biar Robosquad lain yang jawab soal kamu

Tanya ke Forum

LATIHAN SOAL GRATIS!

Drill Soal

Latihan soal sesuai topik yang kamu mau untuk persiapan ujian

Cobain Drill Soal

Perdalam pemahamanmu bersama Master Teacher
di sesi Live Teaching, GRATIS!

Pertanyaan serupa

1. Jelaskanpenggunaam metode metagenom dapat dimanfaatkan untuk menemukan produk-produk bioteknologi yang bermanfaat pada bidang farmasi. Uraikan jawaban anda dengan menjelaskan definisi, contoh produk dan teknik pembuatan produk 2. Pemerintah Indonesia menggunakan 3 metode untuk mendeteksi keberadaan SARS-cov2,yaitu tes cepat antibodi, tes cepat molekuler, dan real time PCR. a.Jelaskan perbedaan prinsip kerja ketiga cara tersebut! b.Jelaskan tahap-tahap real time PCR, gen target, urutan primer yang digunakan, siklusamplifikasi. Tuliskan sumber referensi yang anda gunakan 3. Sebutkan urutan asam amino hasil translasi yang dikode oleh “DNA templat” berikut ini:3’ atttacgatagtttcgatagacaaaagtcaattcgtttcgaattatcaattgccgcatcactt 5’ 4.Berikan salah satu jurnal penelitian pembuatan DNA rekombinan pada bidang farmasi,kemudian: a.Gambarkan plasmid yang digunakan sebagai vektor pembuatan DNA rekombinan! b.Jelaskan arti dan fungsi setiap notasi dalam gambar!

4

0.0

Jawaban terverifikasi