Kayla U

25 Maret 2024 03:46

Iklan

Iklan

Kayla U

25 Maret 2024 03:46

Pertanyaan

Berdasarkan faktor-faktor dalam berinteraksi, grooming merupakan salah satu upaya untuk menumbuhkan simpati. Bagaimanakah pendapat Anda terhadap pernyataan tersebut? Berikan alasan Anda.

Berdasarkan faktor-faktor dalam berinteraksi, grooming merupakan salah satu upaya untuk menumbuhkan simpati. Bagaimanakah pendapat Anda terhadap pernyataan tersebut? Berikan alasan Anda.


401

2

Jawaban terverifikasi

Iklan

Iklan

Salsabila M

Community

27 Maret 2024 14:10

Jawaban terverifikasi

<p>Pernyataan tersebut memiliki dasar yang kuat dalam ilmu perilaku hewan dan psikologi. Grooming, atau proses membersihkan dan merapikan bulu atau tubuh, umumnya terjadi pada banyak spesies hewan, terutama mamalia sosial seperti primata, kucing, anjing, dan burung. Meskipun tindakan ini memiliki manfaat fisik, seperti membersihkan bulu dari parasit atau kotoran, grooming juga memiliki implikasi sosial yang penting.</p><p>Dalam konteks hubungan sosial antara individu-individu dalam sebuah kelompok atau komunitas, grooming sering kali merupakan bentuk interaksi sosial yang penting. Proses grooming antara individu dapat memperkuat ikatan sosial dan memperkuat hubungan antaranggota kelompok. Selain itu, grooming juga dapat menyebabkan pelepasan hormon yang dapat meningkatkan rasa kenyamanan dan rasa simpati antara individu yang terlibat.</p><p>Dalam banyak spesies, termasuk primata non-manusia seperti monyet, grooming digunakan sebagai alat untuk memperkuat hierarki sosial, menjaga perdamaian di antara anggota kelompok, dan membangun hubungan sosial yang dekat. Dalam hal ini, grooming dapat dianggap sebagai salah satu upaya untuk menumbuhkan simpati atau rasa saling peduli antara individu dalam kelompok.</p><p>Dengan demikian, pernyataan tersebut memiliki landasan yang kuat dalam pemahaman tentang perilaku sosial hewan dan dapat diterima dalam konteks interaksi sosial di antara berbagai spesies.</p><p>&nbsp;</p><p>&nbsp;</p><p>&nbsp;</p><p><br>&nbsp;</p>

Pernyataan tersebut memiliki dasar yang kuat dalam ilmu perilaku hewan dan psikologi. Grooming, atau proses membersihkan dan merapikan bulu atau tubuh, umumnya terjadi pada banyak spesies hewan, terutama mamalia sosial seperti primata, kucing, anjing, dan burung. Meskipun tindakan ini memiliki manfaat fisik, seperti membersihkan bulu dari parasit atau kotoran, grooming juga memiliki implikasi sosial yang penting.

Dalam konteks hubungan sosial antara individu-individu dalam sebuah kelompok atau komunitas, grooming sering kali merupakan bentuk interaksi sosial yang penting. Proses grooming antara individu dapat memperkuat ikatan sosial dan memperkuat hubungan antaranggota kelompok. Selain itu, grooming juga dapat menyebabkan pelepasan hormon yang dapat meningkatkan rasa kenyamanan dan rasa simpati antara individu yang terlibat.

Dalam banyak spesies, termasuk primata non-manusia seperti monyet, grooming digunakan sebagai alat untuk memperkuat hierarki sosial, menjaga perdamaian di antara anggota kelompok, dan membangun hubungan sosial yang dekat. Dalam hal ini, grooming dapat dianggap sebagai salah satu upaya untuk menumbuhkan simpati atau rasa saling peduli antara individu dalam kelompok.

Dengan demikian, pernyataan tersebut memiliki landasan yang kuat dalam pemahaman tentang perilaku sosial hewan dan dapat diterima dalam konteks interaksi sosial di antara berbagai spesies.

 

 

 


 


Iklan

Iklan

Nanda R

Gold

25 Maret 2024 05:15

<p>Pendapat saya terhadap pernyataan tersebut adalah bahwa grooming memang dapat menjadi salah satu upaya untuk menumbuhkan simpati dalam interaksi sosial, meskipun itu tidak selalu menjadi faktor tunggal atau utama dalam proses tersebut.</p><p>Grooming, atau perawatan diri, dapat mencakup berbagai aktivitas seperti menjaga penampilan fisik, sikap sopan, dan perilaku yang ramah. Ketika seseorang merawat diri dengan baik dan menunjukkan sikap yang menyenangkan dalam interaksi sosial, orang lain cenderung merasa lebih nyaman dan terhubung dengan mereka. Ini dapat menciptakan perasaan simpati atau kebaikan hati terhadap individu tersebut.</p><p>Namun demikian, penting untuk diingat bahwa simpati juga dipengaruhi oleh berbagai faktor lainnya, termasuk sikap, nilai-nilai, kepercayaan, dan perilaku seseorang secara keseluruhan. Selain itu, faktor seperti empati, kesamaan minat, dan pengalaman bersama juga dapat memainkan peran penting dalam membentuk simpati dalam interaksi sosial.</p><p>Jadi, sementara grooming bisa menjadi bagian dari upaya untuk menumbuhkan simpati, hal itu tidaklah cukup dalam isolasi, dan penting untuk memperhatikan faktor-faktor lain yang juga mempengaruhi dinamika interaksi sosial dan pembentukan simpati.</p>

Pendapat saya terhadap pernyataan tersebut adalah bahwa grooming memang dapat menjadi salah satu upaya untuk menumbuhkan simpati dalam interaksi sosial, meskipun itu tidak selalu menjadi faktor tunggal atau utama dalam proses tersebut.

Grooming, atau perawatan diri, dapat mencakup berbagai aktivitas seperti menjaga penampilan fisik, sikap sopan, dan perilaku yang ramah. Ketika seseorang merawat diri dengan baik dan menunjukkan sikap yang menyenangkan dalam interaksi sosial, orang lain cenderung merasa lebih nyaman dan terhubung dengan mereka. Ini dapat menciptakan perasaan simpati atau kebaikan hati terhadap individu tersebut.

Namun demikian, penting untuk diingat bahwa simpati juga dipengaruhi oleh berbagai faktor lainnya, termasuk sikap, nilai-nilai, kepercayaan, dan perilaku seseorang secara keseluruhan. Selain itu, faktor seperti empati, kesamaan minat, dan pengalaman bersama juga dapat memainkan peran penting dalam membentuk simpati dalam interaksi sosial.

Jadi, sementara grooming bisa menjadi bagian dari upaya untuk menumbuhkan simpati, hal itu tidaklah cukup dalam isolasi, dan penting untuk memperhatikan faktor-faktor lain yang juga mempengaruhi dinamika interaksi sosial dan pembentukan simpati.


lock

Yah, akses pembahasan gratismu habis


atau

Dapatkan jawaban pertanyaanmu di AiRIS. Langsung dijawab oleh bestie pintar

Tanya Sekarang

Mau pemahaman lebih dalam untuk soal ini?

Tanya ke Forum

Biar Robosquad lain yang jawab soal kamu

Tanya ke Forum

LATIHAN SOAL GRATIS!

Drill Soal

Latihan soal sesuai topik yang kamu mau untuk persiapan ujian

Cobain Drill Soal

Perdalam pemahamanmu bersama Master Teacher
di sesi Live Teaching, GRATIS!

Pertanyaan serupa

1. Jelaskanpenggunaam metode metagenom dapat dimanfaatkan untuk menemukan produk-produk bioteknologi yang bermanfaat pada bidang farmasi. Uraikan jawaban anda dengan menjelaskan definisi, contoh produk dan teknik pembuatan produk 2. Pemerintah Indonesia menggunakan 3 metode untuk mendeteksi keberadaan SARS-cov2,yaitu tes cepat antibodi, tes cepat molekuler, dan real time PCR. a.Jelaskan perbedaan prinsip kerja ketiga cara tersebut! b.Jelaskan tahap-tahap real time PCR, gen target, urutan primer yang digunakan, siklusamplifikasi. Tuliskan sumber referensi yang anda gunakan 3. Sebutkan urutan asam amino hasil translasi yang dikode oleh “DNA templat” berikut ini:3’ atttacgatagtttcgatagacaaaagtcaattcgtttcgaattatcaattgccgcatcactt 5’ 4.Berikan salah satu jurnal penelitian pembuatan DNA rekombinan pada bidang farmasi,kemudian: a.Gambarkan plasmid yang digunakan sebagai vektor pembuatan DNA rekombinan! b.Jelaskan arti dan fungsi setiap notasi dalam gambar!

4

0.0

Jawaban terverifikasi