Anisa T

18 Maret 2024 09:21

Iklan

Iklan

Anisa T

18 Maret 2024 09:21

Pertanyaan

Apabila ketiga hambatan dihubungkan dengan sumber tegangan 6 V dan hambatan dalam 1 2, maka besar kuat arus yang mengalir pada hambatan 6 Ω adalah

Apabila ketiga hambatan dihubungkan dengan sumber tegangan 6 V dan hambatan dalam 1 2, maka besar kuat arus yang mengalir pada hambatan 6 Ω adalah

alt

1

1

Jawaban terverifikasi

Iklan

Iklan

Simeon N

18 Maret 2024 13:54

Jawaban terverifikasi

<p>Semoga Membantu</p>

Semoga Membantu

alt

Iklan

Iklan

lock

Yah, akses pembahasan gratismu habis


atau

Dapatkan jawaban pertanyaanmu di AiRIS. Langsung dijawab oleh bestie pintar

Tanya Sekarang

Mau pemahaman lebih dalam untuk soal ini?

Tanya ke Forum

Biar Robosquad lain yang jawab soal kamu

Tanya ke Forum

LATIHAN SOAL GRATIS!

Drill Soal

Latihan soal sesuai topik yang kamu mau untuk persiapan ujian

Cobain Drill Soal

Perdalam pemahamanmu bersama Master Teacher
di sesi Live Teaching, GRATIS!

Pertanyaan serupa

1. Jelaskanpenggunaam metode metagenom dapat dimanfaatkan untuk menemukan produk-produk bioteknologi yang bermanfaat pada bidang farmasi. Uraikan jawaban anda dengan menjelaskan definisi, contoh produk dan teknik pembuatan produk 2. Pemerintah Indonesia menggunakan 3 metode untuk mendeteksi keberadaan SARS-cov2,yaitu tes cepat antibodi, tes cepat molekuler, dan real time PCR. a.Jelaskan perbedaan prinsip kerja ketiga cara tersebut! b.Jelaskan tahap-tahap real time PCR, gen target, urutan primer yang digunakan, siklusamplifikasi. Tuliskan sumber referensi yang anda gunakan 3. Sebutkan urutan asam amino hasil translasi yang dikode oleh “DNA templat” berikut ini:3’ atttacgatagtttcgatagacaaaagtcaattcgtttcgaattatcaattgccgcatcactt 5’ 4.Berikan salah satu jurnal penelitian pembuatan DNA rekombinan pada bidang farmasi,kemudian: a.Gambarkan plasmid yang digunakan sebagai vektor pembuatan DNA rekombinan! b.Jelaskan arti dan fungsi setiap notasi dalam gambar!

6

0.0

Jawaban terverifikasi