Ni P

14 Maret 2024 14:20

Iklan

Iklan

Ni P

14 Maret 2024 14:20

Pertanyaan

Apa informasi yang diterima oleh 3 tokoh Indonesia saat dipanggil ke sigen dalan vietnam?

Apa informasi yang diterima oleh 3 tokoh Indonesia saat dipanggil ke sigen dalan vietnam?


7

2

Jawaban terverifikasi

Iklan

Iklan

Salsabila M

Community

19 Maret 2024 02:27

Jawaban terverifikasi

<p>Tokoh-tokoh Indonesia yang dipanggil ke Sigen dalam Vietnam pada tanggal 17 Agustus 1945, yang terkenal dengan Konferensi Sigen, adalah Soekarno, Mohammad Hatta, dan Mr. Radjiman. Mereka menerima informasi bahwa Jepang telah menyerah kepada Sekutu pada Perang Dunia II. Selain itu, mereka juga mendengar tentang rencana Sekutu untuk menjadikan Vietnam sebagai zona pendudukan sementara dan memberikan kemerdekaan kepada Indonesia. Hal ini memberi dorongan bagi mereka untuk menyatakan kemerdekaan Indonesia.</p><p>&nbsp;</p><p>&nbsp;</p><p>&nbsp;</p><p>&nbsp;</p><p><br>&nbsp;</p>

Tokoh-tokoh Indonesia yang dipanggil ke Sigen dalam Vietnam pada tanggal 17 Agustus 1945, yang terkenal dengan Konferensi Sigen, adalah Soekarno, Mohammad Hatta, dan Mr. Radjiman. Mereka menerima informasi bahwa Jepang telah menyerah kepada Sekutu pada Perang Dunia II. Selain itu, mereka juga mendengar tentang rencana Sekutu untuk menjadikan Vietnam sebagai zona pendudukan sementara dan memberikan kemerdekaan kepada Indonesia. Hal ini memberi dorongan bagi mereka untuk menyatakan kemerdekaan Indonesia.

 

 

 

 


 


Iklan

Iklan

Nanda R

Gold

21 Maret 2024 12:41

<p><br>Saat dipanggil ke Sigen Dalan (juga dikenal sebagai Ho Chi Minh Trail) di Vietnam, tiga tokoh Indonesia yang dikirim oleh Presiden Soekarno pada tahun 1965 adalah Soekarno sendiri, Menteri Pertahanan dan Keamanan Abdul Haris Nasution, dan Menteri Luar Negeri Subandrio.</p><p>Informasi yang diterima oleh ketiga tokoh tersebut terkait dengan pengalaman dan strategi perang gerilya yang dilakukan oleh pasukan Viet Cong (National Front for the Liberation of South Vietnam) melawan pasukan Amerika Serikat dan sekutu mereka selama Perang Vietnam. Mereka belajar tentang teknik dan taktik perang gerilya, penggunaan jaringan gua dan terowongan, serta logistik dan pasokan senjata yang dilakukan oleh gerilyawan Vietnam.</p><p>Kunjungan ini dimaksudkan untuk memberikan pemahaman yang lebih baik kepada pemimpin Indonesia tentang strategi perang gerilya dan upaya perlawanan rakyat Vietnam terhadap invasi asing. Hal ini juga bertujuan untuk memperkuat hubungan antara Indonesia dan Vietnam dalam konteks perjuangan melawan imperialisme dan kolonialisme.</p><p>&nbsp;</p><p>&nbsp;</p><p><br>&nbsp;</p>


Saat dipanggil ke Sigen Dalan (juga dikenal sebagai Ho Chi Minh Trail) di Vietnam, tiga tokoh Indonesia yang dikirim oleh Presiden Soekarno pada tahun 1965 adalah Soekarno sendiri, Menteri Pertahanan dan Keamanan Abdul Haris Nasution, dan Menteri Luar Negeri Subandrio.

Informasi yang diterima oleh ketiga tokoh tersebut terkait dengan pengalaman dan strategi perang gerilya yang dilakukan oleh pasukan Viet Cong (National Front for the Liberation of South Vietnam) melawan pasukan Amerika Serikat dan sekutu mereka selama Perang Vietnam. Mereka belajar tentang teknik dan taktik perang gerilya, penggunaan jaringan gua dan terowongan, serta logistik dan pasokan senjata yang dilakukan oleh gerilyawan Vietnam.

Kunjungan ini dimaksudkan untuk memberikan pemahaman yang lebih baik kepada pemimpin Indonesia tentang strategi perang gerilya dan upaya perlawanan rakyat Vietnam terhadap invasi asing. Hal ini juga bertujuan untuk memperkuat hubungan antara Indonesia dan Vietnam dalam konteks perjuangan melawan imperialisme dan kolonialisme.

 

 


 


lock

Yah, akses pembahasan gratismu habis


atau

Dapatkan jawaban pertanyaanmu di AiRIS. Langsung dijawab oleh bestie pintar

Tanya Sekarang

Mau pemahaman lebih dalam untuk soal ini?

Tanya ke Forum

Biar Robosquad lain yang jawab soal kamu

Tanya ke Forum

LATIHAN SOAL GRATIS!

Drill Soal

Latihan soal sesuai topik yang kamu mau untuk persiapan ujian

Cobain Drill Soal

Perdalam pemahamanmu bersama Master Teacher
di sesi Live Teaching, GRATIS!

Pertanyaan serupa

1. Jelaskanpenggunaam metode metagenom dapat dimanfaatkan untuk menemukan produk-produk bioteknologi yang bermanfaat pada bidang farmasi. Uraikan jawaban anda dengan menjelaskan definisi, contoh produk dan teknik pembuatan produk 2. Pemerintah Indonesia menggunakan 3 metode untuk mendeteksi keberadaan SARS-cov2,yaitu tes cepat antibodi, tes cepat molekuler, dan real time PCR. a.Jelaskan perbedaan prinsip kerja ketiga cara tersebut! b.Jelaskan tahap-tahap real time PCR, gen target, urutan primer yang digunakan, siklusamplifikasi. Tuliskan sumber referensi yang anda gunakan 3. Sebutkan urutan asam amino hasil translasi yang dikode oleh “DNA templat” berikut ini:3’ atttacgatagtttcgatagacaaaagtcaattcgtttcgaattatcaattgccgcatcactt 5’ 4.Berikan salah satu jurnal penelitian pembuatan DNA rekombinan pada bidang farmasi,kemudian: a.Gambarkan plasmid yang digunakan sebagai vektor pembuatan DNA rekombinan! b.Jelaskan arti dan fungsi setiap notasi dalam gambar!

2

0.0

Jawaban terverifikasi