Nanas N

16 Mei 2024 15:16



Nanas N

16 Mei 2024 15:16


Abstrak Penelitian ini bertujuan untuk mengetahui bahaya yang ditimbulkan dari limbah tempe, untuk mengetahui cara meminimalisasi limbah tempe agar tepat guna, dan untuk mengetahui cara memberdayakan masyarakat melalui pemanfaatan limbah tempe menjadi pupuk tepat guna. Metode yang digunakan pada penelitian a ini adalah pendekatan kualitatif studi lapangan. Teknik pengambilan data menggunakan beberapa cara, di antaranya wawancara yang dilakukan peneliti dengan bertanya kepada narasumber, metode observasinya dilakukan dengan pengamatan pada objek baik secara langsung maupun tidak langsung, dan metode dokumentasi kita peroleh melalui foto ataupun video. Informasi yang sesuai dengan isi karya ilmiah di atas adalah.. a. Peneliti melakukan wawancara sebagai cara pengambilan data. b. Peneliti menggunakan kuesioner sebagai cara pengambilan data. C. Salah satu tujuan penelitian adalah mengetahui cara mengolah limbah tempe. d. Metode observasi yang dilakukan adalah melakukan tes pada objek penelitian. e. Salah satu tujuan penelitian adalah mengetahui manfaat limbah tempe bagi lingkungan.



Jawaban terverifikasi



Kevin L


23 Mei 2024 01:33

Jawaban terverifikasi

【Jawaban】: a. Peneliti melakukan wawancara sebagai cara pengambilan data. 【Penjelasan】: Dalam karya ilmiah tersebut, peneliti menggunakan metode wawancara sebagai salah satu cara pengambilan data. Hal ini dapat dilihat dari kalimat "Teknik pengambilan data menggunakan beberapa cara, di antaranya wawancara yang dilakukan peneliti dengan bertanya kepada narasumber". Oleh karena itu, jawaban yang paling sesuai dengan informasi yang diberikan dalam karya ilmiah tersebut adalah pilihan a.



Khalifahtul R


19 Mei 2024 03:27

<p>Jawaban yang benar adalah D.</p>

Jawaban yang benar adalah D.


Yah, akses pembahasan gratismu habis


Dapatkan jawaban pertanyaanmu di AiRIS. Langsung dijawab oleh bestie pintar

Tanya Sekarang

Mau pemahaman lebih dalam untuk soal ini?

Tanya ke Forum

Biar Robosquad lain yang jawab soal kamu

Tanya ke Forum


Drill Soal

Latihan soal sesuai topik yang kamu mau untuk persiapan ujian

Cobain Drill Soal

Perdalam pemahamanmu bersama Master Teacher
di sesi Live Teaching, GRATIS!

Pertanyaan serupa

1. Jelaskanpenggunaam metode metagenom dapat dimanfaatkan untuk menemukan produk-produk bioteknologi yang bermanfaat pada bidang farmasi. Uraikan jawaban anda dengan menjelaskan definisi, contoh produk dan teknik pembuatan produk 2. Pemerintah Indonesia menggunakan 3 metode untuk mendeteksi keberadaan SARS-cov2,yaitu tes cepat antibodi, tes cepat molekuler, dan real time PCR. a.Jelaskan perbedaan prinsip kerja ketiga cara tersebut! b.Jelaskan tahap-tahap real time PCR, gen target, urutan primer yang digunakan, siklusamplifikasi. Tuliskan sumber referensi yang anda gunakan 3. Sebutkan urutan asam amino hasil translasi yang dikode oleh “DNA templat” berikut ini:3’ atttacgatagtttcgatagacaaaagtcaattcgtttcgaattatcaattgccgcatcactt 5’ 4.Berikan salah satu jurnal penelitian pembuatan DNA rekombinan pada bidang farmasi,kemudian: a.Gambarkan plasmid yang digunakan sebagai vektor pembuatan DNA rekombinan! b.Jelaskan arti dan fungsi setiap notasi dalam gambar!



Jawaban terverifikasi

1.Bacalah kutipan drama berikut! Abah: "Kalau cari suami harus yang jelas masa depannya, jangan seperti si Kabayan!" Iteung: "Tapi Kang Kabayan mah baik nyaah sama Iteung." Abah: "Baik? Baik apanya? Kalau memang baik pasti suka ngirim uang, paling sedikit ngirim ikan kesenangan Abah. Ikan gurame!" Ambu: "Abah teh kumaha. Apa-apa selalu saja diukur pakai uang." Tokoh Iteung pada kutipan drama tersebut akan lebih menarik jika menggunakan kostum a. celana panjang dan kaos dengan rambut panjang dibiarkan terurai b. celana panjang dan kaos dengan rambut dikepang dua c. kebaya dan celana panjang dengan rambut dibiarkan terurai d. kebaya dan kain dengan rambut di kepang dua 2.Jo : "Hey, jalan yang bener dong!" (keluar dari mobil) Yuda: (tampak terkejut dan menguasai diri) "Maaf Pak." Jo: (melotot) "Maaf, maaf!" (1) Bapak: "Sudahlah Jo, dia sudah minta maaf kok, lagi pula ayah buru- buru nanti terlambat ke kantor." (cepat menyusul keluar dari mobil) Jo : "Tidak bisa, dia harus diberi pela- jaran!" (nyaris melayangkan tinju) (2) Bapak : "Sabar Jo. (melihat kasihan pada Yuda) "Kau pergilah, Nak!" Yuda : "Terima kasih, Pak!" (3) Bapak "Hey, apa yang kau bawa, Nak?" (heran) "Kamu jual lukisan?" Yuda : "lya Pak, ini lukisan kaca." (4) Bapak: "Sungguh baru kali ini aku melihat lukisan kaca, biasanya saya di rumah memajang lukisan kanvas, lukisan kertas, lukisan bulu, dan lain-lain. Tapi, lukisan ini? Ah ya berapa kamu menjual ini?" Yuda: "Yang mana Pak?" (5) Bapak: "Semuanya. Ah sudah jangan bingung, gini aja gimana kalau lukisan itu saya beli lima juta rupiah." Yuda : "Apa? Lima juta!" (6) Bapak: "Apa kurang?" Yuda : "Cu... kup, Pak." Bukti latar waktu dalam kutipan drama tersebut terdapat pada dialog nomor .... a. (1) b. (3) c. (4) d. (6) 3.Perhatikan penggalan drama berikut! "Dari mana saja kau, Badar? Hari sudah petang tapi kau baru pulang," tanya ayah sambil berkacak pinggang. Dialog tersebut diucapkan dengan nada a. keras sambil bercanda b. marah dan serius c. rendah dan penuh tanya d. penuh kasih sayang 4.Cermati kutipan bacaan berikut! "Mohammad-san inilah rumahku." Toshihiko berkata ketika kami sampai di depan sebuah rumah kayu yang sederhana. Lalu berteriak, "Ibu! Ibu! Inilah tamu yang kita tunggu. Lihatlah, seorang Indonesia yang tersesat di kebun anggur Katsunuma. Bukankah ini suatu kehormatan bagi kita?" Bacaan tersebut termasuk teks fiksi karena a. memiliki unsur tema dan tokoh b. bersifat sistematis berdasarkan fakta yang ada c. narasi dan dialog menggunakan ragam bahasa baku d. menggunakan peribahasa untuk membandingkan suatu hal 5.Perhatikan teks berikut! Perkembangan teknologi informatika dalam satu dekade terakhir mengalami lonjakan luar biasa. Munculnya internet memudahkan setiap orang mendapat akses informasi. Tidak hanya sekadar berita, melalui internet orang bisa ber- jualan, memasang iklan, menikmati musik, dan memungkinkan individu mengetahui berbagai peristiwa secara intensif. Berdasarkan wacana tersebut, istilah yang dapat dideretkan dalam indeks dengan tepat adalah a. akses-individu-informatika-informasi- teknologi b. akses-iklan-individu-intensif-internet C. iklan-individu-informasi-intensif-internet d. individu-informasi-intensif-internet-iklan 6.Perhatikan kutipan indeks berikut! Gaib 8 Ilmu Fisika 7 Ilustrasi 57 Imajinasi 59 Implikasi 54 Magnetis 65 Pengetahuan eksakta 46 Pengetahuan keras 47 Pengetahuan lunak 48 Pengetahuan non-eksakta 45 Berikut ini pernyataan yang tidak benar berdasarkan indeks tersebut adalah a. Di halaman 46, kita dapat mempelajari materi pengetahuan keras. b. Materi tentang implikasi dapat kita jumpai di halaman 54. C. Di halaman 45 kita dapat mempelajari pengetahuan non-eksakta d. Pengetahuan eksakta dapat kita pelajari di halaman 46. *kutipan teks drama berikut untuk soal nomor 7 - 9* (1) Mayor: "Berapa lama lagi aku harus menunggu? Lihat semburat matahari sudah terlihat." (sambil menggebrak meja) (2) Kopral: "Sabarlah sedikit, Pak." (3) Mayor "Jangan ditawar lagi." (4) Kopral: "Apanya, Pak?" (5) Mayor: "Kesabarannya! Sejak kemarin kesabaran saya habis. Sabar itu prinsip. Tidak bisa ditawar- tawar, ngerti?" (6) Kopral: "Kalau begitu kuralat ucapanku tadi." (7) Mayor: "Ya, tapi pertanyaanku belum Bung jawab. Berapa lama lagi? Semburat matahari sudah terlihat tu!" 7.Dialog pada kutipan teks drama tersebut yang berisi kramagung ditandai dengan nomor a. (1) b. (3) c. (4) d. (5) 8.Latar disertai bukti nomor pada kutipan drama tersebut adalah .... a.. siang hari, bukti pada dialog nomor (7) b. menjelang maghrib, bukti pada dialog nomor (5) c.pagi hari, bukti pada dialog nomor (7) d. sore hari, bukti pada dialog nomor (1) 9.Amanat yang sesuai dengan kutipan teks drama tersebut adalah .... a. Kemarahan bukanlah cara penyelesaian masalah yang bijak. b. Seorang bawahan tidak sepatutnya melawan atasan sekalipun untuk membela kebenaran. c. Kita harus lebih banyak bersabar menghadapi apa pun. d. Kita harus mengikuti keinginan atasan walaupun tidak sejalan dengannya. *kutipan drama berikut untuk soal nomor 10-13* Fikri: "Hai sobat. Lho ada apa ini? Kamu kok kelihatan sedih?" Bayu: "Enggak. Perasaan kamu saja." Fikri: "Ayolah... Aku kenal kamu dari kecil. Aku bisa tahu kamu sedih, senang, malas, atau marah? Ayo katakan padaku siapa tahu aku bisa membantu." Bayu: "Kamu ini tau aja. Hari ini hari terakhir aku harus membayar SPP. Bapakku masih di luar kota. Ibuku sakit. Aku bingung harus bagaimana." Fikri :"Kenapa harus bingung. Aku bisa membantumu." Bayu: "Maksudmu?" Fikri: "Ya... membantumu. Aku punya uang tabungan dan cukup untuk membayar SPP mu." Bayu: "Wah... enggak ... enggak ... enggak aku tidak bisa menggunakan uang tabunganmu." Fikri: "Ayolah teman... aku tulus... kapan-kapan kamu dapat mengembalikannya." 10. Tema yang digambarkan pada kutipan drama tersebut adalah a. persahabatan antara kedua orang b. tolong-menolong antarteman yang mem- butuhkan c. persahabatan yang didukung oleh kedua orang tua d. masalah ekonomi keluarga yang tak kunjung reda 11.Tokoh Fikri dalam kutipan drama tersebut memiliki watak a. rendah hati b. tinggi hati c. baik hati d. kecil hati 12. Kutipan drama suasana tersebut menceritakan a. haru b. kaget c. kecewa d. sedih 13.(sambil terpogoh-pogoh masuk kamar tamu, Naja menangis) Naja: "Bu, aku sudah tidak kuat lagi kalau begini." Ibu: "Percayalah, Nak, masalah ini akan segera teratasi. Tuhan Maha Pengatur dan Mahabaik." Naja: "Tapi kapan? Kapan? Aku bosan sudah!" Ibu: "Bersabarlah, Nak. Jika sabar, masalah akan terurai satu per satu." (sambil membelai rambut Naja dengan penuh Kesabaran). Dalam struktur teks drama, kutipan tersebut merupakan bagian .... a. orientasi b. resolusi c. komplikasi d. epilog *kutipan buku berikut untuk soal nomor 14 dan 15* Bumi adalah tempat di mana kita, manusia, dan makhluk hidup lainnya berada. Bumi sering disebut juga sebagai planet biru. Kenapa? Karena bumi kalau dilihat dari luar angkasa terlihat dengan warna dominan biru. Tahukah kamu warna biru bumi yang terlihat dari angkasa raya itu? Itu adalah lautan. Karena sekitar 70% permukaan bumi merupakan lautan yang sangat luas. Sisanya 30% merupakan daratan yang tersusun atas dataran, gunung, dan lembah. Bumi juga dikelilingi oleh lapisan atmosfer yang merupakan pelindung bumi. 14. Teks tersebut tergolong sebagai karya nonfiksi karena .... a. berisi cerita karangan manusia b. bersifat informatif dan berisi kenyataan c. berasal dari imajinasi pengarang d. memiliki makna ganda 15. Inti dari kutipan buku tersebut adalah .... a. memaparkan tentang alam dan kerusakannya b. memaparkan secara detail tentang bumi c. menggambarkan tentang jenis-jenis atmosfer d. menjelaskan jenis-jenis planet 16.Bacalah kutipan teks fiksi berikut! Kehidupan keluarga ini sangat sederhana. Ayah dan Ibu setiap hari membanting tulang di ladang, seolah-olah kepala jadi betis, betis jadi kepala demi beberapa mulut yang harus dipenuhi. Orang tua ini ikhlas bekerja dengan tanggung jawab demi keluarga dan anak-anaknya kelak supaya jadi orang. Tak ada rotan akar pun jadi, begitulah kata orang tua itu. Daya tarik cuplikan teks fiksi tersebut tampak pada..... a. konflik dalam cerita b. latar cerita c. gaya bahasa penulis d. tema cerita 17.Perhatikan cuplikan teks berikut! Perempuan memang paling rentan terhadap anemia, terutama anemia karena kekurangan zat besi. Darah memang sangat penting bagi perempuan. Hal ini terutama pada saat hamil, zat besi itu dibagi dua, yaitu bagi si ibu dan janinnya. Apabila si ibu mengalami anemia, bisa terjadi abortus, lahir prematur, dan juga kematian saat melahirkan. Bahkan, bagi janin, zat besi juga dibutuhkan, terutama juga ada kaitannya dengan kecerdasan. Topik untuk diskusi berdasarkan bacaan tersebut adalah a. manfaat zat besi bagi bayi b. kesehatan ibu dan janin C. anemia sebagai penyakit berbahaya bagi perempuan d. sebab-sebab tingginya kernatian bayi dan anak di Indonesia *indeks berikut untuk soal nomor 18 dan 19* Aliterasi, 89, 93 Amanat, 5, 70 Arbitrer, 3, 65 Artikel, 8, 90 Balada, 25, 75 Drama, 89, 99 Epilog, 34, 36, 74 Fiksi, 3, 25, 90 18. Berdasarkan indeks buku nonfiksi tersebut, kita dapat menemukan istilah epilog di halaman.... a. 3,65 b. 25,75 c. 34, 36, dan 74 d. 3, 25, dan 90 19. Berdasarkan indeks buku tersebut, saat membuka halaman 25 kita dapat menemukan kata .... a. balada dan epilog b. balada dan fiksi c. balada dan drama d. balada



Jawaban terverifikasi

