Aisyah N

19 Februari 2024 02:44

Iklan

Iklan

Aisyah N

19 Februari 2024 02:44

Pertanyaan

1. Mengapa globalisasi menyebabkan modernisasi di suatu negara? 2. Jelaskan ketimpangan sosial dalam kaitannya dengan perubahan sosial dan globalisasi? 3. Sebutkan ketimpangan sosial dalam bidang ekonomi!

1. Mengapa globalisasi menyebabkan modernisasi di suatu negara?

2. Jelaskan ketimpangan sosial dalam kaitannya  dengan perubahan sosial dan globalisasi?

3. Sebutkan ketimpangan sosial dalam bidang ekonomi!


9

2

Jawaban terverifikasi

Iklan

Iklan

Erwin A

Community

20 Februari 2024 04:28

Jawaban terverifikasi

<h2><strong>Globalisasi dan Modernisasi</strong></h2><p><strong>1. Mengapa globalisasi menyebabkan modernisasi di suatu negara?</strong></p><p>Globalisasi adalah proses keterkaitan dan ketergantungan antar negara di dunia dalam berbagai bidang, seperti ekonomi, politik, budaya, dan teknologi. Modernisasi adalah proses perubahan sosial yang mengarah pada masyarakat yang lebih maju dan sejahtera.</p><p><strong>Beberapa alasan mengapa globalisasi menyebabkan modernisasi di suatu negara:</strong></p><ul><li><strong>Transfer teknologi:</strong> Globalisasi memungkinkan transfer teknologi dari negara maju ke negara berkembang. Teknologi baru dapat meningkatkan produktivitas dan efisiensi dalam berbagai bidang, seperti pertanian, industri, dan jasa.</li><li><strong>Aliran modal:</strong> Globalisasi memungkinkan aliran modal dari negara maju ke negara berkembang. Modal ini dapat digunakan untuk membiayai pembangunan infrastruktur, pendidikan, dan kesehatan.</li><li><strong>Pertukaran ide dan budaya:</strong> Globalisasi memungkinkan pertukaran ide dan budaya antar negara. Pertukaran ini dapat mendorong inovasi dan kreativitas, serta meningkatkan pemahaman antar budaya.</li><li><strong>Peningkatan standar hidup:</strong> Globalisasi dapat meningkatkan standar hidup di negara berkembang melalui peningkatan pendapatan dan akses ke barang dan jasa.</li></ul><p><strong>2. Jelaskan ketimpangan sosial dalam kaitannya dengan perubahan sosial dan globalisasi?</strong></p><p>Ketimpangan sosial adalah keadaan di mana terjadi ketidakseimbangan dalam distribusi sumber daya, seperti pendapatan, kekayaan, pendidikan, dan kesehatan. Ketimpangan sosial dapat terjadi antar individu, kelompok, atau wilayah.</p><p><strong>Perubahan sosial dan globalisasi dapat memperparah ketimpangan sosial melalui beberapa mekanisme:</strong></p><ul><li><strong>Peningkatan liberalisasi ekonomi:</strong> Liberalisasi ekonomi dapat menyebabkan keuntungan yang lebih besar bagi mereka yang sudah kaya dan berkuasa, sementara mereka yang miskin dan terpinggirkan semakin tertinggal.</li><li><strong>Perubahan teknologi:</strong> Perubahan teknologi dapat menyebabkan hilangnya pekerjaan bagi mereka yang tidak memiliki keterampilan yang dibutuhkan.</li><li><strong>Globalisasi:</strong> Globalisasi dapat menyebabkan perusahaan multinasional mendominasi pasar, sehingga perusahaan lokal kecil dan menengah sulit untuk bersaing.</li></ul><p><strong>3. Sebutkan ketimpangan sosial dalam bidang ekonomi!</strong></p><p>Ketimpangan sosial dalam bidang ekonomi dapat dilihat dari beberapa indikator, seperti:</p><ul><li><strong>Distribusi pendapatan:</strong> Ketimpangan pendapatan terjadi ketika sebagian kecil masyarakat menguasai sebagian besar pendapatan.</li><li><strong>Kemiskinan:</strong> Kemiskinan adalah kondisi di mana seseorang tidak memiliki cukup sumber daya untuk memenuhi kebutuhan dasar hidupnya.</li><li><strong>Pengangguran:</strong> Pengangguran adalah kondisi di mana seseorang tidak memiliki pekerjaan.</li><li><strong>Akses ke pendidikan dan kesehatan:</strong> Ketimpangan akses ke pendidikan dan kesehatan dapat menyebabkan perpetuation of inequality.</li></ul><p><strong>Kesimpulan:</strong></p><p>Globalisasi dan modernisasi dapat menyebabkan ketimpangan sosial, dan ketimpangan sosial dapat menghambat globalisasi dan modernisasi. Oleh karena itu, penting untuk merumuskan kebijakan yang dapat mengurangi ketimpangan sosial dan memastikan bahwa globalisasi dan modernisasi bermanfaat bagi semua orang.</p>

Globalisasi dan Modernisasi

1. Mengapa globalisasi menyebabkan modernisasi di suatu negara?

Globalisasi adalah proses keterkaitan dan ketergantungan antar negara di dunia dalam berbagai bidang, seperti ekonomi, politik, budaya, dan teknologi. Modernisasi adalah proses perubahan sosial yang mengarah pada masyarakat yang lebih maju dan sejahtera.

Beberapa alasan mengapa globalisasi menyebabkan modernisasi di suatu negara:

  • Transfer teknologi: Globalisasi memungkinkan transfer teknologi dari negara maju ke negara berkembang. Teknologi baru dapat meningkatkan produktivitas dan efisiensi dalam berbagai bidang, seperti pertanian, industri, dan jasa.
  • Aliran modal: Globalisasi memungkinkan aliran modal dari negara maju ke negara berkembang. Modal ini dapat digunakan untuk membiayai pembangunan infrastruktur, pendidikan, dan kesehatan.
  • Pertukaran ide dan budaya: Globalisasi memungkinkan pertukaran ide dan budaya antar negara. Pertukaran ini dapat mendorong inovasi dan kreativitas, serta meningkatkan pemahaman antar budaya.
  • Peningkatan standar hidup: Globalisasi dapat meningkatkan standar hidup di negara berkembang melalui peningkatan pendapatan dan akses ke barang dan jasa.

2. Jelaskan ketimpangan sosial dalam kaitannya dengan perubahan sosial dan globalisasi?

Ketimpangan sosial adalah keadaan di mana terjadi ketidakseimbangan dalam distribusi sumber daya, seperti pendapatan, kekayaan, pendidikan, dan kesehatan. Ketimpangan sosial dapat terjadi antar individu, kelompok, atau wilayah.

Perubahan sosial dan globalisasi dapat memperparah ketimpangan sosial melalui beberapa mekanisme:

  • Peningkatan liberalisasi ekonomi: Liberalisasi ekonomi dapat menyebabkan keuntungan yang lebih besar bagi mereka yang sudah kaya dan berkuasa, sementara mereka yang miskin dan terpinggirkan semakin tertinggal.
  • Perubahan teknologi: Perubahan teknologi dapat menyebabkan hilangnya pekerjaan bagi mereka yang tidak memiliki keterampilan yang dibutuhkan.
  • Globalisasi: Globalisasi dapat menyebabkan perusahaan multinasional mendominasi pasar, sehingga perusahaan lokal kecil dan menengah sulit untuk bersaing.

3. Sebutkan ketimpangan sosial dalam bidang ekonomi!

Ketimpangan sosial dalam bidang ekonomi dapat dilihat dari beberapa indikator, seperti:

  • Distribusi pendapatan: Ketimpangan pendapatan terjadi ketika sebagian kecil masyarakat menguasai sebagian besar pendapatan.
  • Kemiskinan: Kemiskinan adalah kondisi di mana seseorang tidak memiliki cukup sumber daya untuk memenuhi kebutuhan dasar hidupnya.
  • Pengangguran: Pengangguran adalah kondisi di mana seseorang tidak memiliki pekerjaan.
  • Akses ke pendidikan dan kesehatan: Ketimpangan akses ke pendidikan dan kesehatan dapat menyebabkan perpetuation of inequality.

Kesimpulan:

Globalisasi dan modernisasi dapat menyebabkan ketimpangan sosial, dan ketimpangan sosial dapat menghambat globalisasi dan modernisasi. Oleh karena itu, penting untuk merumuskan kebijakan yang dapat mengurangi ketimpangan sosial dan memastikan bahwa globalisasi dan modernisasi bermanfaat bagi semua orang.


Iklan

Iklan

Salsabila M

Community

09 Maret 2024 22:43

Jawaban terverifikasi

<p><strong>Mengapa globalisasi menyebabkan modernisasi di suatu negara?</strong></p><p>Globalisasi dapat menyebabkan modernisasi di suatu negara karena adanya arus informasi, teknologi, dan budaya yang melintasi batas-batas nasional. Integrasi ekonomi dan pertukaran ide-ide dari berbagai belahan dunia dapat mendorong pertumbuhan ekonomi, pengadopsian teknologi modern, serta perubahan dalam gaya hidup dan nilai-nilai masyarakat. Globalisasi membuka akses terhadap inovasi dan perkembangan terkini, mendorong negara-negara untuk beradaptasi dengan perubahan-perubahan tersebut.</p><p><strong>Ketimpangan sosial dalam kaitannya dengan perubahan sosial dan globalisasi:</strong></p><p>Ketimpangan sosial, baik dalam hal ekonomi, pendidikan, atau akses terhadap sumber daya, dapat menjadi konsekuensi dari perubahan sosial dan globalisasi. Proses globalisasi seringkali dapat memperkuat ketidaksetaraan yang sudah ada atau menciptakan ketidaksetaraan baru. Orang-orang atau kelompok-kelompok tertentu yang memiliki akses lebih besar terhadap peluang dan sumber daya global akan menjadi lebih unggul, sementara yang lain mungkin tertinggal.</p><p><strong>Ketimpangan sosial dalam bidang ekonomi:</strong></p><p>a. <strong>Penghasilan dan Kekayaan:</strong> Terdapat kesenjangan antara kelompok yang memiliki penghasilan dan kekayaan tinggi dengan kelompok yang memiliki penghasilan rendah.</p><p>b. <strong>Akses terhadap Pendidikan dan Peluang Ekonomi:</strong> Beberapa kelompok masyarakat mungkin memiliki lebih sedikit akses terhadap pendidikan berkualitas dan peluang ekonomi yang setara, menciptakan ketidaksetaraan dalam pembangunan karier dan kesejahteraan.</p><p>c. <strong>Kesenjangan Regional:</strong> Adanya perbedaan pembangunan ekonomi antar wilayah atau kota, di mana beberapa daerah menjadi pusat pertumbuhan ekonomi sementara yang lain mengalami keterbelakangan ekonomi.</p><p>d. <strong>Ketidaksetaraan Kesempatan Bisnis:</strong> Beberapa kelompok atau individu mungkin lebih mudah mengakses kesempatan bisnis dan pasar global, sementara yang lain terkendala oleh faktor-faktor seperti modal awal atau akses teknologi.</p><p>Ketimpangan sosial dalam bidang ekonomi bisa menciptakan ketidaksetaraan yang dapat menjadi tantangan bagi pembangunan berkelanjutan dan kesejahteraan masyarakat secara keseluruhan.</p><p>&nbsp;</p><p>&nbsp;</p><p>&nbsp;</p><p><br>&nbsp;</p>

Mengapa globalisasi menyebabkan modernisasi di suatu negara?

Globalisasi dapat menyebabkan modernisasi di suatu negara karena adanya arus informasi, teknologi, dan budaya yang melintasi batas-batas nasional. Integrasi ekonomi dan pertukaran ide-ide dari berbagai belahan dunia dapat mendorong pertumbuhan ekonomi, pengadopsian teknologi modern, serta perubahan dalam gaya hidup dan nilai-nilai masyarakat. Globalisasi membuka akses terhadap inovasi dan perkembangan terkini, mendorong negara-negara untuk beradaptasi dengan perubahan-perubahan tersebut.

Ketimpangan sosial dalam kaitannya dengan perubahan sosial dan globalisasi:

Ketimpangan sosial, baik dalam hal ekonomi, pendidikan, atau akses terhadap sumber daya, dapat menjadi konsekuensi dari perubahan sosial dan globalisasi. Proses globalisasi seringkali dapat memperkuat ketidaksetaraan yang sudah ada atau menciptakan ketidaksetaraan baru. Orang-orang atau kelompok-kelompok tertentu yang memiliki akses lebih besar terhadap peluang dan sumber daya global akan menjadi lebih unggul, sementara yang lain mungkin tertinggal.

Ketimpangan sosial dalam bidang ekonomi:

a. Penghasilan dan Kekayaan: Terdapat kesenjangan antara kelompok yang memiliki penghasilan dan kekayaan tinggi dengan kelompok yang memiliki penghasilan rendah.

b. Akses terhadap Pendidikan dan Peluang Ekonomi: Beberapa kelompok masyarakat mungkin memiliki lebih sedikit akses terhadap pendidikan berkualitas dan peluang ekonomi yang setara, menciptakan ketidaksetaraan dalam pembangunan karier dan kesejahteraan.

c. Kesenjangan Regional: Adanya perbedaan pembangunan ekonomi antar wilayah atau kota, di mana beberapa daerah menjadi pusat pertumbuhan ekonomi sementara yang lain mengalami keterbelakangan ekonomi.

d. Ketidaksetaraan Kesempatan Bisnis: Beberapa kelompok atau individu mungkin lebih mudah mengakses kesempatan bisnis dan pasar global, sementara yang lain terkendala oleh faktor-faktor seperti modal awal atau akses teknologi.

Ketimpangan sosial dalam bidang ekonomi bisa menciptakan ketidaksetaraan yang dapat menjadi tantangan bagi pembangunan berkelanjutan dan kesejahteraan masyarakat secara keseluruhan.

 

 

 


 


lock

Yah, akses pembahasan gratismu habis


atau

Dapatkan jawaban pertanyaanmu di AiRIS. Langsung dijawab oleh bestie pintar

Tanya Sekarang

Mau pemahaman lebih dalam untuk soal ini?

Tanya ke Forum

Biar Robosquad lain yang jawab soal kamu

Tanya ke Forum

LATIHAN SOAL GRATIS!

Drill Soal

Latihan soal sesuai topik yang kamu mau untuk persiapan ujian

Cobain Drill Soal

Perdalam pemahamanmu bersama Master Teacher
di sesi Live Teaching, GRATIS!

Pertanyaan serupa

1. Jelaskanpenggunaam metode metagenom dapat dimanfaatkan untuk menemukan produk-produk bioteknologi yang bermanfaat pada bidang farmasi. Uraikan jawaban anda dengan menjelaskan definisi, contoh produk dan teknik pembuatan produk 2. Pemerintah Indonesia menggunakan 3 metode untuk mendeteksi keberadaan SARS-cov2,yaitu tes cepat antibodi, tes cepat molekuler, dan real time PCR. a.Jelaskan perbedaan prinsip kerja ketiga cara tersebut! b.Jelaskan tahap-tahap real time PCR, gen target, urutan primer yang digunakan, siklusamplifikasi. Tuliskan sumber referensi yang anda gunakan 3. Sebutkan urutan asam amino hasil translasi yang dikode oleh “DNA templat” berikut ini:3’ atttacgatagtttcgatagacaaaagtcaattcgtttcgaattatcaattgccgcatcactt 5’ 4.Berikan salah satu jurnal penelitian pembuatan DNA rekombinan pada bidang farmasi,kemudian: a.Gambarkan plasmid yang digunakan sebagai vektor pembuatan DNA rekombinan! b.Jelaskan arti dan fungsi setiap notasi dalam gambar!

4

0.0

Jawaban terverifikasi