M.Ardiansyah R

02 Maret 2024 11:35

Iklan

Iklan

M.Ardiansyah R

02 Maret 2024 11:35

Pertanyaan

1. Bagaimana cara mengenali kearifan masyarakat yang ada di dunia? 2. Bagaimana cara mempromosikan budaya bangsa Indonesia dalam dunia yang terhubung? 3. Bagaimana cara melakukan kolaborasi budaya dalam dunia yang saling terhubung?

1. Bagaimana cara mengenali kearifan masyarakat yang ada di dunia? 

2. Bagaimana cara mempromosikan budaya bangsa Indonesia dalam dunia yang terhubung? 

3. Bagaimana cara melakukan kolaborasi budaya dalam dunia yang saling terhubung? 


3

2

Jawaban terverifikasi

Iklan

Iklan

Suli P

06 Maret 2024 01:46

Jawaban terverifikasi

1. **Mengenali Kearifan Masyarakat di Dunia:** - Studi Antropologi: Melakukan penelitian antropologis untuk memahami kearifan lokal, tradisi, dan nilai-nilai masyarakat di berbagai belahan dunia. - Dialog Antarbudaya: Membuka dialog dengan masyarakat setempat, mendengarkan cerita mereka, dan menghormati keberagaman budaya yang ada. 2. **Mempromosikan Budaya Bangsa Indonesia:** - Media Sosial dan Digital: Menggunakan media sosial dan platform digital untuk mempromosikan seni, kuliner, tradisi, dan keindahan alam Indonesia secara global. - Festival dan Pameran Budaya: Mengadakan festival budaya atau pameran seni yang melibatkan seniman, perancang, dan budayawan Indonesia di berbagai negara. - Diplomasi Budaya: Melibatkan duta budaya, seniman, dan tokoh budaya untuk menjadi duta besar budaya Indonesia yang dapat mempromosikan kekayaan budaya di tingkat internasional. 3. **Melakukan Kolaborasi Budaya:** - Pertukaran Budaya: Mengadakan program pertukaran budaya antara negara-negara untuk meningkatkan pemahaman dan menggali potensi kerja sama dalam seni, pendidikan, dan bidang lainnya. - Proyek Kolaboratif: Menyelenggarakan proyek kolaboratif antarbudaya di bidang seni, musik, atau film yang melibatkan orang dari berbagai latar belakang. - Kemitraan Budaya: Membangun kemitraan dengan institusi budaya, museum, dan lembaga seni di berbagai negara untuk mengadakan kegiatan bersama dan memperkuat hubungan antarbudaya. Dengan menggabungkan pendekatan ini, dapat dibentuk jaringan global yang saling terhubung, mempromosikan keragaman budaya, dan memungkinkan kolaborasi yang saling menguntungkan di dunia yang semakin terkoneksi.


Iklan

Iklan

Nanda R

Gold

07 Maret 2024 21:45

Jawaban terverifikasi

<p><strong>1. Mengenali Kearifan Masyarakat di Dunia:</strong></p><ul><li><strong>Studi Antropologi dan Etnografi:</strong><ul><li>Melakukan penelitian dan studi mendalam tentang kehidupan masyarakat di berbagai belahan dunia untuk memahami nilai, norma, dan kearifan lokal.</li></ul></li><li><strong>Interaksi dan Dialog Lintas Budaya:</strong><ul><li>Terlibat dalam interaksi langsung dengan masyarakat lokal, berdialog, dan membangun hubungan untuk memahami kehidupan sehari-hari dan perspektif mereka.</li></ul></li><li><strong>Partisipasi dalam Kegiatan Lokal:</strong><ul><li>Ikut serta dalam kegiatan budaya, upacara adat, dan peristiwa lokal untuk merasakan dan memahami kearifan masyarakat setempat.</li></ul></li></ul><p><strong>2. Mempromosikan Budaya Bangsa Indonesia:</strong></p><ul><li><strong>Pameran Budaya:</strong><ul><li>Mengadakan pameran seni, kuliner, dan kerajinan tangan Indonesia di tingkat internasional untuk memperkenalkan kekayaan budaya.</li></ul></li><li><strong>Penggunaan Media Sosial:</strong><ul><li>Memanfaatkan media sosial untuk membagikan cerita, gambar, dan informasi terkait budaya Indonesia kepada audiens global.</li></ul></li><li><strong>Kolaborasi Seni dan Kreativitas:</strong><ul><li>Mengajak seniman dan kreatif Indonesia untuk berkolaborasi dengan seniman dari berbagai negara dalam proyek-proyek seni yang mendunia.</li></ul></li></ul><p><strong>3. Melakukan Kolaborasi Budaya dalam Dunia yang Terhubung:</strong></p><ul><li><strong>Program Pertukaran Budaya:</strong><ul><li>Mendorong dan mendukung program pertukaran budaya, baik melibatkan seniman, pelajar, atau pekerja budaya dari berbagai negara.</li></ul></li><li><strong>Kolaborasi Seni dan Budaya:</strong><ul><li>Membangun kolaborasi antarbudaya dalam bidang seni, musik, dan peran untuk menciptakan karya yang mencerminkan keanekaragaman dan kesatuan.</li></ul></li><li><strong>Forum Diskusi dan Konferensi:</strong><ul><li>Mengadakan forum diskusi dan konferensi internasional yang melibatkan pemikir, budayawan, dan pemimpin masyarakat untuk bertukar ide dan pengalaman.</li></ul></li></ul>

1. Mengenali Kearifan Masyarakat di Dunia:

  • Studi Antropologi dan Etnografi:
    • Melakukan penelitian dan studi mendalam tentang kehidupan masyarakat di berbagai belahan dunia untuk memahami nilai, norma, dan kearifan lokal.
  • Interaksi dan Dialog Lintas Budaya:
    • Terlibat dalam interaksi langsung dengan masyarakat lokal, berdialog, dan membangun hubungan untuk memahami kehidupan sehari-hari dan perspektif mereka.
  • Partisipasi dalam Kegiatan Lokal:
    • Ikut serta dalam kegiatan budaya, upacara adat, dan peristiwa lokal untuk merasakan dan memahami kearifan masyarakat setempat.

2. Mempromosikan Budaya Bangsa Indonesia:

  • Pameran Budaya:
    • Mengadakan pameran seni, kuliner, dan kerajinan tangan Indonesia di tingkat internasional untuk memperkenalkan kekayaan budaya.
  • Penggunaan Media Sosial:
    • Memanfaatkan media sosial untuk membagikan cerita, gambar, dan informasi terkait budaya Indonesia kepada audiens global.
  • Kolaborasi Seni dan Kreativitas:
    • Mengajak seniman dan kreatif Indonesia untuk berkolaborasi dengan seniman dari berbagai negara dalam proyek-proyek seni yang mendunia.

3. Melakukan Kolaborasi Budaya dalam Dunia yang Terhubung:

  • Program Pertukaran Budaya:
    • Mendorong dan mendukung program pertukaran budaya, baik melibatkan seniman, pelajar, atau pekerja budaya dari berbagai negara.
  • Kolaborasi Seni dan Budaya:
    • Membangun kolaborasi antarbudaya dalam bidang seni, musik, dan peran untuk menciptakan karya yang mencerminkan keanekaragaman dan kesatuan.
  • Forum Diskusi dan Konferensi:
    • Mengadakan forum diskusi dan konferensi internasional yang melibatkan pemikir, budayawan, dan pemimpin masyarakat untuk bertukar ide dan pengalaman.

lock

Yah, akses pembahasan gratismu habis


atau

Dapatkan jawaban pertanyaanmu di AiRIS. Langsung dijawab oleh bestie pintar

Tanya Sekarang

Mau pemahaman lebih dalam untuk soal ini?

Tanya ke Forum

Biar Robosquad lain yang jawab soal kamu

Tanya ke Forum

LATIHAN SOAL GRATIS!

Drill Soal

Latihan soal sesuai topik yang kamu mau untuk persiapan ujian

Cobain Drill Soal

Perdalam pemahamanmu bersama Master Teacher
di sesi Live Teaching, GRATIS!

Pertanyaan serupa

1. Jelaskanpenggunaam metode metagenom dapat dimanfaatkan untuk menemukan produk-produk bioteknologi yang bermanfaat pada bidang farmasi. Uraikan jawaban anda dengan menjelaskan definisi, contoh produk dan teknik pembuatan produk 2. Pemerintah Indonesia menggunakan 3 metode untuk mendeteksi keberadaan SARS-cov2,yaitu tes cepat antibodi, tes cepat molekuler, dan real time PCR. a.Jelaskan perbedaan prinsip kerja ketiga cara tersebut! b.Jelaskan tahap-tahap real time PCR, gen target, urutan primer yang digunakan, siklusamplifikasi. Tuliskan sumber referensi yang anda gunakan 3. Sebutkan urutan asam amino hasil translasi yang dikode oleh “DNA templat” berikut ini:3’ atttacgatagtttcgatagacaaaagtcaattcgtttcgaattatcaattgccgcatcactt 5’ 4.Berikan salah satu jurnal penelitian pembuatan DNA rekombinan pada bidang farmasi,kemudian: a.Gambarkan plasmid yang digunakan sebagai vektor pembuatan DNA rekombinan! b.Jelaskan arti dan fungsi setiap notasi dalam gambar!

4

0.0

Jawaban terverifikasi