Iklan

Iklan

Pertanyaan

Anemia sel sabit adalah penyakit yang diakibatkan oleh mutasi pada gen yang mengkode protein globin penyusun hemoglobin. Fungsi hemoglobin adalah membawa oksigen dalam sel darah merah. Mutasi pada anemia sel sabit menyebabkan sel darah merah menjadi kaku dan berbentuk sabit ketika melepaskan oksigen. Berikut adalah mutasi yang terjadi pada sekuens gen protein globin: Normal sekuens gen protein globin: CACGTGGACTGAGGACTCCTC Sekuens gen yang termutasi: CACGTGGACTGAGGAC A CCTC Gunakan tabel asam amino di bawah ini! Pernyataan yang tepat mengenai anemia sel sabit yaitu ….

Anemia sel sabit adalah penyakit yang diakibatkan oleh mutasi pada gen yang mengkode protein globin penyusun hemoglobin. Fungsi hemoglobin adalah membawa oksigen dalam sel darah merah. Mutasi pada anemia sel sabit menyebabkan sel darah merah menjadi kaku dan berbentuk sabit ketika melepaskan oksigen. Berikut adalah mutasi yang terjadi pada sekuens gen protein globin:

Normal sekuens gen protein globin:

CACGTGGACTGAGGACTCCTC

Sekuens gen yang termutasi:

CACGTGGACTGAGGACACCTC

Gunakan tabel asam amino di bawah ini!


Pernyataan yang tepat mengenai anemia sel sabit yaitu ….

  1. mutasi yang terjadi adalah transisi

  2. jumlah asam amino yang dihasilkan DNA mutan lebih sedikit dibandingkan asam amino yang dihasilkan DNA normal

  3. mutasi di atas dapat dikategorikan sebagai mutasi missense

  4. polipeptida yang terbentuk lebih pendek

  5. mutasi tersebut menghasilkan protein globin yang tidak fungsional

Iklan

M. Marwnto

Master Teacher

Jawaban terverifikasi

Jawaban

jawaban yang tepat adalah C.

jawaban yang tepat adalah C. 

Iklan

Pembahasan

Pada soal diketahui bahwa sekuens gen protein globin normal dan yang mengalami mutasi adalah: Normal sekuens gen protein globin: CACGTGGACTGAGGACTCCTC Sekuens gen yang termutasi: CACGTGGACTGAGGAC A CCTC Mutasi yang terjadi adalah substitusi jenis transversi , karena T (pirimidin) berubah menjadi A (purin). Pada sekuens normal, mRNA yang dihasilkan yaitu: Normal sekuens gen protein globin: CACGTGGACTGAGGACTCCTC mRNA normal: GUG CAC CUG ACU CCU GAG GAG (terbentuk 6 asam amino) Rantai polipeptida yang terbentuk: Val-His-Leu-Thr-Pro- Glu -Glu Sekuens gen yang termutasi: CACGTGGACTGAGGAC A CCTC mRNA DNA yang termutasi: GUG CAC CUG ACU CCU GUG GAG (terbentuk 6 asam amino) Rantai polipeptida yang terbentuk: Val-His-Leu-Thr-Pro- Val -Glu Dengan demikian, panjang polipeptida atau jumlah asam aminonya tidak berkurang. Mutasi tersebut dapat dikategorikan sebagai mutasi missense karena terjadi perubahan asam amino dari asam glutamat menjadi valin. Protein yang dihasilkan masih fungsional namun efisiensi pengikatan oksigen menjadi menurun oleh karena strukturnya yang berubah. Dengan demikian, jawaban yang tepat adalah C.

Pada soal diketahui bahwa sekuens gen protein globin normal dan yang mengalami mutasi adalah:

Normal sekuens gen protein globin:

CACGTGGACTGAGGACTCCTC

Sekuens gen yang termutasi:

CACGTGGACTGAGGACACCTC

Mutasi yang terjadi adalah substitusi jenis transversi, karena T (pirimidin) berubah menjadi A (purin). Pada sekuens normal, mRNA yang dihasilkan yaitu:

Normal sekuens gen protein globin:

CACGTGGACTGAGGACTCCTC

mRNA normal:

GUG CAC CUG ACU CCU GAG GAG (terbentuk 6 asam amino)

Rantai polipeptida yang terbentuk:

Val-His-Leu-Thr-Pro-Glu-Glu

 

Sekuens gen yang termutasi:

CACGTGGACTGAGGACACCTC

mRNA DNA yang termutasi:

GUG CAC CUG ACU CCU GUG GAG (terbentuk 6 asam amino)

Rantai polipeptida yang terbentuk:

Val-His-Leu-Thr-Pro-Val-Glu

 

Dengan demikian, panjang polipeptida atau jumlah asam aminonya tidak berkurang. Mutasi tersebut dapat dikategorikan sebagai mutasi missense karena terjadi perubahan asam amino dari asam glutamat menjadi valin. 
Protein yang dihasilkan masih fungsional namun efisiensi pengikatan oksigen menjadi menurun oleh karena strukturnya yang berubah.

Dengan demikian, jawaban yang tepat adalah C. 

Latihan Bab

Konsep Dasar dan Klasifikasi Mutasi

Mutasi Gen

Mutasi Kromosom

Kelainan pada Manusia Akibat Mutasi

Perdalam pemahamanmu bersama Master Teacher
di sesi Live Teaching, GRATIS!

223

Iklan

Iklan

Pertanyaan serupa

Sindrom jacob merupakan kelainan yang disebabkan perubahan pada kromosom seks. Adapun ciri-ciri yang dimiliki yaitu laki-laki dengan badan tinggi besar, agresif, sulit memusatkan perhatian, dan lainny...

72

5.0

Jawaban terverifikasi

Iklan

Iklan

RUANGGURU HQ

Jl. Dr. Saharjo No.161, Manggarai Selatan, Tebet, Kota Jakarta Selatan, Daerah Khusus Ibukota Jakarta 12860

Coba GRATIS Aplikasi Roboguru

Coba GRATIS Aplikasi Ruangguru

Download di Google PlayDownload di AppstoreDownload di App Gallery

Produk Ruangguru

Fitur Roboguru

Topik Roboguru

Hubungi Kami

Ruangguru WhatsApp

081578200000

Email info@ruangguru.com

info@ruangguru.com

Contact 02140008000

02140008000

Ikuti Kami

©2023 Ruangguru. All Rights Reserved PT. Ruang Raya Indonesia