Kerenhappuch O

13 Maret 2024 05:17

Iklan

Iklan

Kerenhappuch O

13 Maret 2024 05:17

Pertanyaan

tuliskan 2 contoh pantun nasehat?

tuliskan 2 contoh pantun nasehat?


2

2

Jawaban terverifikasi

Iklan

Iklan

Suli P

13 Maret 2024 09:13

Jawaban terverifikasi

1. Jangan malas bekerja berat, Hasilnya pasti akan memuaskan hati. Rajin dan tekun jadi pegangan, Sukses akan datang bersama senyuman. 2. Hati bersih, jangan berdusta, Kebaikan akan menjadi teman abadi. Jaga tutur, bijak dalam kata, Kehidupan indah, bersemi harmoni.


Iklan

Iklan

Sumber W

Silver

13 Maret 2024 09:58

Jawaban terverifikasi

<p>Rusa kecil diam terkurung</p><p>Kurang makan kurang minum</p><p>Cari ilmu jangan murung</p><p>Cerialah selalu banyak tersenyum</p><p>&nbsp;</p><p>Ke restoran membeli makan</p><p>Perginya bersama sang istri</p><p>Perintah Tuhan ayo kerjakan</p><p>Larangan Tuhan ayo jauhi</p>

Rusa kecil diam terkurung

Kurang makan kurang minum

Cari ilmu jangan murung

Cerialah selalu banyak tersenyum

 

Ke restoran membeli makan

Perginya bersama sang istri

Perintah Tuhan ayo kerjakan

Larangan Tuhan ayo jauhi


lock

Yah, akses pembahasan gratismu habis


atau

Dapatkan jawaban pertanyaanmu di AiRIS. Langsung dijawab oleh bestie pintar

Tanya Sekarang

Mau pemahaman lebih dalam untuk soal ini?

Tanya ke Forum

Biar Robosquad lain yang jawab soal kamu

Tanya ke Forum

Roboguru Plus

Dapatkan pembahasan soal ga pake lama, langsung dari Tutor!

Chat Tutor

Perdalam pemahamanmu bersama Master Teacher
di sesi Live Teaching, GRATIS!

Pertanyaan serupa

1. Jelaskanpenggunaam metode metagenom dapat dimanfaatkan untuk menemukan produk-produk bioteknologi yang bermanfaat pada bidang farmasi. Uraikan jawaban anda dengan menjelaskan definisi, contoh produk dan teknik pembuatan produk 2. Pemerintah Indonesia menggunakan 3 metode untuk mendeteksi keberadaan SARS-cov2,yaitu tes cepat antibodi, tes cepat molekuler, dan real time PCR. a.Jelaskan perbedaan prinsip kerja ketiga cara tersebut! b.Jelaskan tahap-tahap real time PCR, gen target, urutan primer yang digunakan, siklusamplifikasi. Tuliskan sumber referensi yang anda gunakan 3. Sebutkan urutan asam amino hasil translasi yang dikode oleh “DNA templat” berikut ini:3’ atttacgatagtttcgatagacaaaagtcaattcgtttcgaattatcaattgccgcatcactt 5’ 4.Berikan salah satu jurnal penelitian pembuatan DNA rekombinan pada bidang farmasi,kemudian: a.Gambarkan plasmid yang digunakan sebagai vektor pembuatan DNA rekombinan! b.Jelaskan arti dan fungsi setiap notasi dalam gambar!

2

0.0

Jawaban terverifikasi