Aurellia J

13 Februari 2024 12:55

Iklan

Iklan

Aurellia J

13 Februari 2024 12:55

Pertanyaan

kenapa variabel pada umumnya menggunakan x dan y bukan yang lainn?

kenapa variabel pada umumnya menggunakan x dan y bukan yang lainn?


1

2

Jawaban terverifikasi

Iklan

Iklan

Vanzy V

13 Februari 2024 15:00

Jawaban terverifikasi

Ada banyak alasannya, kita singkatin saja. Sejarah: Penggunaan x dan y untuk variabel sudah ada sejak zaman Descartes (abad ke-17) dalam geometri analitik. Dia menggunakan x untuk mewakili sumbu horizontal dan y untuk sumbu vertikal. Seiring waktu, penggunaan x dan y untuk variabel menjadi kebiasaan dan standar dalam matematika dan ilmu pengetahuan lainnya. Kemudahan: Huruf x dan y mudah ditulis dan dibaca, baik dalam bentuk cetak maupun tulisan tangan. Huruf x dan y tidak memiliki makna khusus dalam bahasa Inggris, sehingga penggunaannya untuk variabel tidak membingungkan. Konvensi: Dalam banyak bidang, seperti matematika, fisika, dan ilmu komputer, penggunaan x dan y untuk variabel sudah menjadi konvensi yang diterima secara umum. Penggunaan konvensi ini membantu para ilmuwan dan programmer untuk saling memahami dan berkomunikasi dengan lebih mudah. Pilihan lain: Meskipun x dan y adalah pilihan yang paling umum, huruf lain juga dapat digunakan untuk variabel, seperti a, b, c, z. Pilihan huruf biasanya tergantung pada konteks dan preferensi pribadi. Kesimpulan: Penggunaan x dan y untuk variabel adalah hasil dari sejarah, kemudahan, konvensi, dan preferensi. Meskipun pilihan lain dimungkinkan, x dan y tetap menjadi pilihan yang paling umum dan diterima secara luas.


Iklan

Iklan

ITWB I

14 Februari 2024 22:52

<p>untuk memudahkan</p>

untuk memudahkan


lock

Yah, akses pembahasan gratismu habis


atau

Dapatkan jawaban pertanyaanmu di AiRIS. Langsung dijawab oleh bestie pintar

Tanya Sekarang

Mau pemahaman lebih dalam untuk soal ini?

Tanya ke Forum

Biar Robosquad lain yang jawab soal kamu

Tanya ke Forum

Roboguru Plus

Dapatkan pembahasan soal ga pake lama, langsung dari Tutor!

Chat Tutor

Perdalam pemahamanmu bersama Master Teacher
di sesi Live Teaching, GRATIS!

Pertanyaan serupa

1. Jelaskanpenggunaam metode metagenom dapat dimanfaatkan untuk menemukan produk-produk bioteknologi yang bermanfaat pada bidang farmasi. Uraikan jawaban anda dengan menjelaskan definisi, contoh produk dan teknik pembuatan produk 2. Pemerintah Indonesia menggunakan 3 metode untuk mendeteksi keberadaan SARS-cov2,yaitu tes cepat antibodi, tes cepat molekuler, dan real time PCR. a.Jelaskan perbedaan prinsip kerja ketiga cara tersebut! b.Jelaskan tahap-tahap real time PCR, gen target, urutan primer yang digunakan, siklusamplifikasi. Tuliskan sumber referensi yang anda gunakan 3. Sebutkan urutan asam amino hasil translasi yang dikode oleh “DNA templat” berikut ini:3’ atttacgatagtttcgatagacaaaagtcaattcgtttcgaattatcaattgccgcatcactt 5’ 4.Berikan salah satu jurnal penelitian pembuatan DNA rekombinan pada bidang farmasi,kemudian: a.Gambarkan plasmid yang digunakan sebagai vektor pembuatan DNA rekombinan! b.Jelaskan arti dan fungsi setiap notasi dalam gambar!

2

0.0

Jawaban terverifikasi