Elsa F

26 Februari 2024 06:57

Iklan

Iklan

Elsa F

26 Februari 2024 06:57

Pertanyaan

Diana melakukan penelitian mengenai pengaruh pemberian ekstrak bawang putih terhadap kadar leukosit dalam darah tingkat organisasi kehidupan yang dipelajari pada penelitian tersebut adalah


110

1


Iklan

Iklan

Yuni H

28 Februari 2024 10:42

<p>Pada penelitian yang dilakukan oleh Diana mengenai pengaruh pemberian ekstrak bawang putih terhadap kadar leukosit dalam darah, yang dipelajari adalah tingkat sel atau tingkat organ. Fokus penelitian tersebut adalah pada dampak ekstrak bawang putih terhadap jumlah atau aktivitas leukosit, yang merupakan sel-sel darah putih yang memiliki peran penting dalam sistem kekebalan tubuh. Tingkat organisasi kehidupan yang dipelajari mencakup tingkat sel atau tingkat organ, di mana pengaruh ekstrak bawang putih pada tingkat ini dapat memberikan wawasan tentang respons tubuh terhadap zat tersebut.</p>

Pada penelitian yang dilakukan oleh Diana mengenai pengaruh pemberian ekstrak bawang putih terhadap kadar leukosit dalam darah, yang dipelajari adalah tingkat sel atau tingkat organ. Fokus penelitian tersebut adalah pada dampak ekstrak bawang putih terhadap jumlah atau aktivitas leukosit, yang merupakan sel-sel darah putih yang memiliki peran penting dalam sistem kekebalan tubuh. Tingkat organisasi kehidupan yang dipelajari mencakup tingkat sel atau tingkat organ, di mana pengaruh ekstrak bawang putih pada tingkat ini dapat memberikan wawasan tentang respons tubuh terhadap zat tersebut.


Iklan

Iklan

Mau jawaban yang terverifikasi?

Tanya ke Forum

Biar Robosquad lain yang jawab soal kamu

Tanya ke Forum

LATIHAN SOAL GRATIS!

Drill Soal

Latihan soal sesuai topik yang kamu mau untuk persiapan ujian

Cobain Drill Soal

Perdalam pemahamanmu bersama Master Teacher
di sesi Live Teaching, GRATIS!

Pertanyaan serupa

1. Jelaskanpenggunaam metode metagenom dapat dimanfaatkan untuk menemukan produk-produk bioteknologi yang bermanfaat pada bidang farmasi. Uraikan jawaban anda dengan menjelaskan definisi, contoh produk dan teknik pembuatan produk 2. Pemerintah Indonesia menggunakan 3 metode untuk mendeteksi keberadaan SARS-cov2,yaitu tes cepat antibodi, tes cepat molekuler, dan real time PCR. a.Jelaskan perbedaan prinsip kerja ketiga cara tersebut! b.Jelaskan tahap-tahap real time PCR, gen target, urutan primer yang digunakan, siklusamplifikasi. Tuliskan sumber referensi yang anda gunakan 3. Sebutkan urutan asam amino hasil translasi yang dikode oleh “DNA templat” berikut ini:3’ atttacgatagtttcgatagacaaaagtcaattcgtttcgaattatcaattgccgcatcactt 5’ 4.Berikan salah satu jurnal penelitian pembuatan DNA rekombinan pada bidang farmasi,kemudian: a.Gambarkan plasmid yang digunakan sebagai vektor pembuatan DNA rekombinan! b.Jelaskan arti dan fungsi setiap notasi dalam gambar!

6

0.0

Jawaban terverifikasi