M. Alfi

08 Maret 2024 07:49

Iklan

Iklan

M. Alfi

08 Maret 2024 07:49

Pertanyaan

Sifilis, TBC, dan radang paru-paru merupakan jenis penyakit yang dapat menyerang manusia. Penyebab ketiga penyakit tersebut dapat dipelajari dalam cabang ilmu Biologi, yaitu ... A. Virologi B. Genetika C. Mikologi D. Bakteriologi E. Bioteknologi


4

2

Jawaban terverifikasi

Iklan

Iklan

Nanda R

Gold

08 Maret 2024 21:45

Jawaban terverifikasi

jawabannya adalah D. Bakteriologi adalah cabang ilmu biologi yang mempelajari bakteri, termasuk mikroorganisme penyebab penyakit seperti Treponema pallidum yang menyebabkan sifilis, Mycobacterium tuberculosis yang menyebabkan tuberkulosis (TBC), dan bakteri penyebab radang paru-paru.


Iklan

Iklan

Salsabila M

Community

09 Maret 2024 01:42

Jawaban terverifikasi

Penjelasan: Sifilis: Penyebab sifilis adalah bakteri yang disebut Treponema pallidum. Bakteri ini menyebar melalui kontak langsung dengan luka atau lendir dari individu yang terinfeksi. Sifilis dapat menyebabkan gejala awal seperti chancre (luka terbuka) di tempat infeksi awal dan kemudian dapat menyebar ke bagian tubuh lainnya jika tidak diobati. Tuberkulosis (TBC): Tuberkulosis disebabkan oleh bakteri Mycobacterium tuberculosis. Penyakit ini menyebar melalui udara, terutama saat orang yang terinfeksi batuk atau bersin. TBC biasanya menyerang paru-paru, tetapi juga dapat mempengaruhi bagian tubuh lainnya. Infeksi yang tidak diobati dapat menyebabkan gejala parah dan bahkan kematian. Radang Paru-paru: Penyebab radang paru-paru bisa beragam, tetapi bakteri yang sering terlibat adalah Streptococcus pneumoniae. Radang paru-paru dapat disebabkan oleh berbagai mikroorganisme, termasuk bakteri, virus, dan jamur. Infeksi ini menyebabkan peradangan pada jaringan paru-paru dan dapat memengaruhi kemampuan tubuh untuk berfungsi dengan baik. Bakteriologi: Bakteriologi adalah cabang ilmu biologi yang mempelajari bakteri, termasuk struktur, sifat-sifat biologis, dan dampaknya pada organisme. Dalam konteks penyakit manusia, bakteriologi membantu memahami karakteristik bakteri penyebab penyakit dan strategi pengendaliannya, seperti pengembangan antibiotik dan vaksin. Dengan demikian, untuk memahami penyebab sifilis, TBC, dan radang paru-paru, kita dapat merujuk pada pengetahuan yang diperoleh melalui studi dalam cabang ilmu biologi, yaitu bakteriologi.


lock

Yah, akses pembahasan gratismu habis


atau

Dapatkan jawaban pertanyaanmu di AiRIS. Langsung dijawab oleh bestie pintar

Tanya Sekarang

Mau pemahaman lebih dalam untuk soal ini?

Tanya ke Forum

Biar Robosquad lain yang jawab soal kamu

Tanya ke Forum

LATIHAN SOAL GRATIS!

Drill Soal

Latihan soal sesuai topik yang kamu mau untuk persiapan ujian

Cobain Drill Soal

Perdalam pemahamanmu bersama Master Teacher
di sesi Live Teaching, GRATIS!

Pertanyaan serupa

1. Jelaskanpenggunaam metode metagenom dapat dimanfaatkan untuk menemukan produk-produk bioteknologi yang bermanfaat pada bidang farmasi. Uraikan jawaban anda dengan menjelaskan definisi, contoh produk dan teknik pembuatan produk 2. Pemerintah Indonesia menggunakan 3 metode untuk mendeteksi keberadaan SARS-cov2,yaitu tes cepat antibodi, tes cepat molekuler, dan real time PCR. a.Jelaskan perbedaan prinsip kerja ketiga cara tersebut! b.Jelaskan tahap-tahap real time PCR, gen target, urutan primer yang digunakan, siklusamplifikasi. Tuliskan sumber referensi yang anda gunakan 3. Sebutkan urutan asam amino hasil translasi yang dikode oleh “DNA templat” berikut ini:3’ atttacgatagtttcgatagacaaaagtcaattcgtttcgaattatcaattgccgcatcactt 5’ 4.Berikan salah satu jurnal penelitian pembuatan DNA rekombinan pada bidang farmasi,kemudian: a.Gambarkan plasmid yang digunakan sebagai vektor pembuatan DNA rekombinan! b.Jelaskan arti dan fungsi setiap notasi dalam gambar!

6

0.0

Jawaban terverifikasi