Humn H

22 Maret 2024 12:05

Iklan

Iklan

Humn H

22 Maret 2024 12:05

Pertanyaan

misalkan r adalah sebuah relasi pada a= (3,4,6,7,8,11) yang diefinisikan oleh r=[(x,y)] x adalah bil prima dan y adalah bilangan gerap) sesuai dengan definisi tersebut, berapa banyak anggota r


10

1


Iklan

Iklan

Daniel N

23 Maret 2024 08:14

<p>R relasi yang didefinisikan oleh r=[(x,y)] dengan x adalah bilangan prima dan y adalah bilangan gerakan, maka banyaknya anggota r adalah 1.</p>

R relasi yang didefinisikan oleh r=[(x,y)] dengan x adalah bilangan prima dan y adalah bilangan gerakan, maka banyaknya anggota r adalah 1.


Iklan

Iklan

Mau jawaban yang terverifikasi?

Tanya ke Forum

Biar Robosquad lain yang jawab soal kamu

Tanya ke Forum

LATIHAN SOAL GRATIS!

Drill Soal

Latihan soal sesuai topik yang kamu mau untuk persiapan ujian

Cobain Drill Soal

Perdalam pemahamanmu bersama Master Teacher
di sesi Live Teaching, GRATIS!

Pertanyaan serupa

1. Jelaskanpenggunaam metode metagenom dapat dimanfaatkan untuk menemukan produk-produk bioteknologi yang bermanfaat pada bidang farmasi. Uraikan jawaban anda dengan menjelaskan definisi, contoh produk dan teknik pembuatan produk 2. Pemerintah Indonesia menggunakan 3 metode untuk mendeteksi keberadaan SARS-cov2,yaitu tes cepat antibodi, tes cepat molekuler, dan real time PCR. a.Jelaskan perbedaan prinsip kerja ketiga cara tersebut! b.Jelaskan tahap-tahap real time PCR, gen target, urutan primer yang digunakan, siklusamplifikasi. Tuliskan sumber referensi yang anda gunakan 3. Sebutkan urutan asam amino hasil translasi yang dikode oleh “DNA templat” berikut ini:3’ atttacgatagtttcgatagacaaaagtcaattcgtttcgaattatcaattgccgcatcactt 5’ 4.Berikan salah satu jurnal penelitian pembuatan DNA rekombinan pada bidang farmasi,kemudian: a.Gambarkan plasmid yang digunakan sebagai vektor pembuatan DNA rekombinan! b.Jelaskan arti dan fungsi setiap notasi dalam gambar!

4

0.0

Jawaban terverifikasi