Salsabila Y

28 Februari 2024 04:08

Iklan

Iklan

Salsabila Y

28 Februari 2024 04:08

Pertanyaan

jelaskan prinsip kerja antara kloning dan fertilisasi in vitro

jelaskan prinsip kerja antara kloning dan fertilisasi in vitro


1

1

Jawaban terverifikasi

Iklan

Iklan

Queenxi V

28 Februari 2024 10:44

Jawaban terverifikasi

<p>kloning=proses pengambilan sel dari tubuh manusia,baik laki laki atau wanita lalu inti sel diambil dan digabung dengan sel wanita yang udah dibuang inti selnya</p><p>&nbsp;</p><p>fertilisasi vitro=proses pembuahan di luar badan melibatkan secara manual meggabungkan sel telur dan sperma&nbsp;</p>

kloning=proses pengambilan sel dari tubuh manusia,baik laki laki atau wanita lalu inti sel diambil dan digabung dengan sel wanita yang udah dibuang inti selnya

 

fertilisasi vitro=proses pembuahan di luar badan melibatkan secara manual meggabungkan sel telur dan sperma 


Iklan

Iklan

lock

Yah, akses pembahasan gratismu habis


atau

Dapatkan jawaban pertanyaanmu di AiRIS. Langsung dijawab oleh bestie pintar

Tanya Sekarang

Mau pemahaman lebih dalam untuk soal ini?

Tanya ke Forum

Biar Robosquad lain yang jawab soal kamu

Tanya ke Forum

LATIHAN SOAL GRATIS!

Drill Soal

Latihan soal sesuai topik yang kamu mau untuk persiapan ujian

Cobain Drill Soal

Perdalam pemahamanmu bersama Master Teacher
di sesi Live Teaching, GRATIS!

Pertanyaan serupa

1. Jelaskanpenggunaam metode metagenom dapat dimanfaatkan untuk menemukan produk-produk bioteknologi yang bermanfaat pada bidang farmasi. Uraikan jawaban anda dengan menjelaskan definisi, contoh produk dan teknik pembuatan produk 2. Pemerintah Indonesia menggunakan 3 metode untuk mendeteksi keberadaan SARS-cov2,yaitu tes cepat antibodi, tes cepat molekuler, dan real time PCR. a.Jelaskan perbedaan prinsip kerja ketiga cara tersebut! b.Jelaskan tahap-tahap real time PCR, gen target, urutan primer yang digunakan, siklusamplifikasi. Tuliskan sumber referensi yang anda gunakan 3. Sebutkan urutan asam amino hasil translasi yang dikode oleh “DNA templat” berikut ini:3’ atttacgatagtttcgatagacaaaagtcaattcgtttcgaattatcaattgccgcatcactt 5’ 4.Berikan salah satu jurnal penelitian pembuatan DNA rekombinan pada bidang farmasi,kemudian: a.Gambarkan plasmid yang digunakan sebagai vektor pembuatan DNA rekombinan! b.Jelaskan arti dan fungsi setiap notasi dalam gambar!

4

0.0

Jawaban terverifikasi