Khanza T

14 Maret 2024 08:13

Iklan

Iklan

Khanza T

14 Maret 2024 08:13

Pertanyaan

Tentukan konvers dari pernyataan berikut dan tentukan benar / salah konversnya ! Jika salah berikan contoh penyangkalnya ! Jika ∆ABC kongruen ∆PQR, maka luas ∆ABC sama dengan luas ∆PQR

Tentukan konvers dari pernyataan berikut dan tentukan benar / salah konversnya ! Jika salah berikan contoh penyangkalnya !

Jika ∆ABC kongruen ∆PQR, maka luas ∆ABC sama dengan luas ∆PQR


9

1


Iklan

Iklan

N. A

Community

15 Maret 2024 07:44

<p>Konvers dari pernyataan tersebut <strong>salah</strong>. Contoh penyangkalnya ialah ketika 🔺️ABC mempunyai panjang alas dan tinggi yang sama dengan 🔺️PQR tetapi berbeda bentuk.</p><p>&nbsp;</p><p><strong>Penjelasan:</strong></p><p>Konvers dari pernyataan "Jika 🔺️ABC kongruen dengan 🔺️PQR, maka luas 🔺️ABC sama dengan luas 🔺️PQR" adalah "Jika luas 🔺️ABC sama dengan luas 🔺️PQR, maka 🔺️ABC kongruen dengan 🔺️PQR". Maka, pertama kita bisa cek apakah konversnya mungkin salah. Karena sekali saja terbukti salah maka pernyataannya sudah salah.</p><p>Pertama, ingat bahwa luas segitiga adalah ½at. Sehingga kalau alas dan tingginya sama, maka luasnya pasti sama. Padahal, bentuk segitiga dengan alas dan tinggi yang sama bentuknya bisa bermacam-macam. Bisa segitiga siku-siku, sama kaki, dan lain-lain. Maka, konvers dari pernyataan tersebut salah.</p><p>&nbsp;</p><p><strong>Jadi, konvers dari pernyataan "Jika 🔺️ABC kongruen dengan 🔺️PQR, maka luas 🔺️ABC sama dengan luas 🔺️PQR" adalah <u>salah</u>. Contoh penyangkalnya ialah <u>ketika 🔺️ABC mempunyai alas dan tinggi yang sama dengan 🔺️PQR namun berbeda jenis segitiga.</u></strong></p>

Konvers dari pernyataan tersebut salah. Contoh penyangkalnya ialah ketika 🔺️ABC mempunyai panjang alas dan tinggi yang sama dengan 🔺️PQR tetapi berbeda bentuk.

 

Penjelasan:

Konvers dari pernyataan "Jika 🔺️ABC kongruen dengan 🔺️PQR, maka luas 🔺️ABC sama dengan luas 🔺️PQR" adalah "Jika luas 🔺️ABC sama dengan luas 🔺️PQR, maka 🔺️ABC kongruen dengan 🔺️PQR". Maka, pertama kita bisa cek apakah konversnya mungkin salah. Karena sekali saja terbukti salah maka pernyataannya sudah salah.

Pertama, ingat bahwa luas segitiga adalah ½at. Sehingga kalau alas dan tingginya sama, maka luasnya pasti sama. Padahal, bentuk segitiga dengan alas dan tinggi yang sama bentuknya bisa bermacam-macam. Bisa segitiga siku-siku, sama kaki, dan lain-lain. Maka, konvers dari pernyataan tersebut salah.

 

Jadi, konvers dari pernyataan "Jika 🔺️ABC kongruen dengan 🔺️PQR, maka luas 🔺️ABC sama dengan luas 🔺️PQR" adalah salah. Contoh penyangkalnya ialah ketika 🔺️ABC mempunyai alas dan tinggi yang sama dengan 🔺️PQR namun berbeda jenis segitiga.


Iklan

Iklan

Mau jawaban yang terverifikasi?

Tanya ke Forum

Biar Robosquad lain yang jawab soal kamu

Tanya ke Forum

LATIHAN SOAL GRATIS!

Drill Soal

Latihan soal sesuai topik yang kamu mau untuk persiapan ujian

Cobain Drill Soal

Perdalam pemahamanmu bersama Master Teacher
di sesi Live Teaching, GRATIS!

Pertanyaan serupa

1. Jelaskanpenggunaam metode metagenom dapat dimanfaatkan untuk menemukan produk-produk bioteknologi yang bermanfaat pada bidang farmasi. Uraikan jawaban anda dengan menjelaskan definisi, contoh produk dan teknik pembuatan produk 2. Pemerintah Indonesia menggunakan 3 metode untuk mendeteksi keberadaan SARS-cov2,yaitu tes cepat antibodi, tes cepat molekuler, dan real time PCR. a.Jelaskan perbedaan prinsip kerja ketiga cara tersebut! b.Jelaskan tahap-tahap real time PCR, gen target, urutan primer yang digunakan, siklusamplifikasi. Tuliskan sumber referensi yang anda gunakan 3. Sebutkan urutan asam amino hasil translasi yang dikode oleh “DNA templat” berikut ini:3’ atttacgatagtttcgatagacaaaagtcaattcgtttcgaattatcaattgccgcatcactt 5’ 4.Berikan salah satu jurnal penelitian pembuatan DNA rekombinan pada bidang farmasi,kemudian: a.Gambarkan plasmid yang digunakan sebagai vektor pembuatan DNA rekombinan! b.Jelaskan arti dan fungsi setiap notasi dalam gambar!

4

0.0

Jawaban terverifikasi