Mark L

16 Februari 2024 10:50

Iklan

Iklan

Mark L

16 Februari 2024 10:50

Pertanyaan

sebutkan 5 perbedaan budaya lokal dengan budaya nasional

sebutkan 5 perbedaan budaya lokal dengan budaya nasional


7

2

Jawaban terverifikasi

Iklan

Iklan

Na J

17 Februari 2024 05:19

Jawaban terverifikasi

1.Budaya lokal berkembang di satu daerah tertentu, sedangkan budaya nasional adalah gabungan dari berbagai budaya lokal di seluruh wilayah Indonesia. 2.Budaya lokal sangat dipengaruhi oleh adat istiadat dan lingkungan setempat, sedangkan budaya nasional mencakup seluruh nilai dan norma yang ada di Indonesia. 3.Budaya lokal memiliki ciri khas dan keunikan tersendiri, sedangkan budaya nasional memiliki ciri umum dan universal yang mewakili bangsa Indonesia. 4.Budaya lokal meliputi segala bentuk kesenian, kuliner, bahasa, dan tradisi yang berbeda di setiap daerahnya, sedangkan budaya nasional meliputi elemen-elemen seperti bahasa, pakaian tradisional, makanan khas, musik, tari, seni, dan adat istiadat yang dikenal dan dihargai oleh seluruh rakyat Indonesia. 5.Budaya lokal memperkuat keanekaragaman budaya di dalam suatu negara, sementara budaya nasional mengokohkan identitas nasional dan rasa persatuan dan kesatuan bangsa.


Iklan

Iklan

Erwin A

Community

17 Februari 2024 07:47

Jawaban terverifikasi

<h2><br><strong>5 Perbedaan Budaya Lokal dengan Budaya Nasional:</strong></h2><p><strong>1. Cakupan Wilayah:</strong></p><ul><li>Budaya lokal: Bersifat khusus dan hanya berlaku di wilayah atau daerah tertentu.</li><li>Budaya nasional: Bersifat umum dan berlaku di seluruh wilayah negara.</li></ul><p><strong>2. Keberagaman:</strong></p><ul><li>Budaya lokal: Memiliki keragaman yang tinggi dan berbeda-beda di setiap daerah.</li><li>Budaya nasional: Memiliki keseragaman yang lebih tinggi dan menjadi identitas bersama bangsa.</li></ul><p><strong>3. Sifat:</strong></p><ul><li>Budaya lokal: Lebih tradisional dan statis, serta memiliki nilai-nilai yang lebih spesifik.</li><li>Budaya nasional: Lebih modern dan dinamis, serta memiliki nilai-nilai yang lebih universal.</li></ul><p><strong>4. Pengaruh:</strong></p><ul><li>Budaya lokal: Dipengaruhi oleh faktor-faktor lokal seperti adat istiadat, sejarah, dan lingkungan alam.</li><li>Budaya nasional: Dipengaruhi oleh faktor-faktor nasional seperti ideologi negara, politik, dan ekonomi.</li></ul><p><strong>5. Contoh:</strong></p><ul><li>Budaya lokal: Tari tradisional, pakaian adat, bahasa daerah, dan makanan khas.</li><li>Budaya nasional: Bahasa Indonesia, Pancasila, Bhinneka Tunggal Ika, dan Garuda Pancasila.</li></ul><p><strong>Kesimpulan:</strong></p><p>Budaya lokal dan budaya nasional saling berkaitan dan melengkapi satu sama lain. Budaya lokal merupakan kekayaan yang perlu dilestarikan, sedangkan budaya nasional merupakan identitas bersama bangsa.</p><p><strong>Catatan:</strong></p><p>Perbedaan di atas hanyalah gambaran umum. Di beberapa kasus, mungkin terdapat budaya lokal yang memiliki cakupan wilayah yang lebih luas atau budaya nasional yang memiliki sifat yang lebih tradisional.</p>


5 Perbedaan Budaya Lokal dengan Budaya Nasional:

1. Cakupan Wilayah:

  • Budaya lokal: Bersifat khusus dan hanya berlaku di wilayah atau daerah tertentu.
  • Budaya nasional: Bersifat umum dan berlaku di seluruh wilayah negara.

2. Keberagaman:

  • Budaya lokal: Memiliki keragaman yang tinggi dan berbeda-beda di setiap daerah.
  • Budaya nasional: Memiliki keseragaman yang lebih tinggi dan menjadi identitas bersama bangsa.

3. Sifat:

  • Budaya lokal: Lebih tradisional dan statis, serta memiliki nilai-nilai yang lebih spesifik.
  • Budaya nasional: Lebih modern dan dinamis, serta memiliki nilai-nilai yang lebih universal.

4. Pengaruh:

  • Budaya lokal: Dipengaruhi oleh faktor-faktor lokal seperti adat istiadat, sejarah, dan lingkungan alam.
  • Budaya nasional: Dipengaruhi oleh faktor-faktor nasional seperti ideologi negara, politik, dan ekonomi.

5. Contoh:

  • Budaya lokal: Tari tradisional, pakaian adat, bahasa daerah, dan makanan khas.
  • Budaya nasional: Bahasa Indonesia, Pancasila, Bhinneka Tunggal Ika, dan Garuda Pancasila.

Kesimpulan:

Budaya lokal dan budaya nasional saling berkaitan dan melengkapi satu sama lain. Budaya lokal merupakan kekayaan yang perlu dilestarikan, sedangkan budaya nasional merupakan identitas bersama bangsa.

Catatan:

Perbedaan di atas hanyalah gambaran umum. Di beberapa kasus, mungkin terdapat budaya lokal yang memiliki cakupan wilayah yang lebih luas atau budaya nasional yang memiliki sifat yang lebih tradisional.


lock

Yah, akses pembahasan gratismu habis


atau

Dapatkan jawaban pertanyaanmu di AiRIS. Langsung dijawab oleh bestie pintar

Tanya Sekarang

Mau pemahaman lebih dalam untuk soal ini?

Tanya ke Forum

Biar Robosquad lain yang jawab soal kamu

Tanya ke Forum

LATIHAN SOAL GRATIS!

Drill Soal

Latihan soal sesuai topik yang kamu mau untuk persiapan ujian

Cobain Drill Soal

Perdalam pemahamanmu bersama Master Teacher
di sesi Live Teaching, GRATIS!

Pertanyaan serupa

1. Jelaskanpenggunaam metode metagenom dapat dimanfaatkan untuk menemukan produk-produk bioteknologi yang bermanfaat pada bidang farmasi. Uraikan jawaban anda dengan menjelaskan definisi, contoh produk dan teknik pembuatan produk 2. Pemerintah Indonesia menggunakan 3 metode untuk mendeteksi keberadaan SARS-cov2,yaitu tes cepat antibodi, tes cepat molekuler, dan real time PCR. a.Jelaskan perbedaan prinsip kerja ketiga cara tersebut! b.Jelaskan tahap-tahap real time PCR, gen target, urutan primer yang digunakan, siklusamplifikasi. Tuliskan sumber referensi yang anda gunakan 3. Sebutkan urutan asam amino hasil translasi yang dikode oleh “DNA templat” berikut ini:3’ atttacgatagtttcgatagacaaaagtcaattcgtttcgaattatcaattgccgcatcactt 5’ 4.Berikan salah satu jurnal penelitian pembuatan DNA rekombinan pada bidang farmasi,kemudian: a.Gambarkan plasmid yang digunakan sebagai vektor pembuatan DNA rekombinan! b.Jelaskan arti dan fungsi setiap notasi dalam gambar!

4

0.0

Jawaban terverifikasi