Diana D

26 Februari 2024 06:28

Iklan

Iklan

Diana D

26 Februari 2024 06:28

Pertanyaan

Sebutkan 5 alasan pemilihan tembaga sebagai bahan untuk kabel PLN!


17

2

Jawaban terverifikasi

Iklan

Iklan

Yuni H

26 Februari 2024 13:00

Jawaban terverifikasi

<ol><li><strong>Konduktivitas yang Tinggi</strong>: Tembaga memiliki konduktivitas listrik yang sangat baik, artinya dapat mengalirkan listrik dengan efisiensi tinggi. Hal ini penting untuk mengurangi hilangnya energi dalam transmisi listrik jarak jauh.</li><li><strong>Kekuatan dan Ketahanan</strong>: Tembaga memiliki kekuatan yang baik dan tahan terhadap korosi, sehingga dapat digunakan dalam berbagai kondisi lingkungan dan cuaca tanpa mengalami kerusakan yang signifikan.</li><li><strong>Kemampuan Membentuk</strong>: Tembaga dapat dibentuk dengan mudah menjadi kabel yang halus dan lentur, memungkinkan instalasi yang lebih fleksibel dan efisien di berbagai jenis medan, termasuk area perkotaan yang padat.</li><li><strong>Daya Hantar yang Stabil</strong>: Kabel tembaga memberikan daya hantar yang stabil dan konsisten, yang penting untuk menjaga keandalan sistem distribusi listrik dan meminimalkan gangguan dalam pasokan listrik.</li><li><strong>Umur Pakai yang Panjang</strong>: Tembaga memiliki umur pakai yang panjang dan membutuhkan sedikit perawatan, sehingga biaya operasional dan pemeliharaannya relatif rendah dalam jangka panjang.</li></ol>

  1. Konduktivitas yang Tinggi: Tembaga memiliki konduktivitas listrik yang sangat baik, artinya dapat mengalirkan listrik dengan efisiensi tinggi. Hal ini penting untuk mengurangi hilangnya energi dalam transmisi listrik jarak jauh.
  2. Kekuatan dan Ketahanan: Tembaga memiliki kekuatan yang baik dan tahan terhadap korosi, sehingga dapat digunakan dalam berbagai kondisi lingkungan dan cuaca tanpa mengalami kerusakan yang signifikan.
  3. Kemampuan Membentuk: Tembaga dapat dibentuk dengan mudah menjadi kabel yang halus dan lentur, memungkinkan instalasi yang lebih fleksibel dan efisien di berbagai jenis medan, termasuk area perkotaan yang padat.
  4. Daya Hantar yang Stabil: Kabel tembaga memberikan daya hantar yang stabil dan konsisten, yang penting untuk menjaga keandalan sistem distribusi listrik dan meminimalkan gangguan dalam pasokan listrik.
  5. Umur Pakai yang Panjang: Tembaga memiliki umur pakai yang panjang dan membutuhkan sedikit perawatan, sehingga biaya operasional dan pemeliharaannya relatif rendah dalam jangka panjang.

Diana D

26 Februari 2024 22:28

Terimakasih Kaka Yuni🙏🏻

Iklan

Iklan

Sumber W

Silver

27 Februari 2024 07:36

Jawaban terverifikasi

<p>Tembaga banyak digunakan sebagai kabel listrik karena beberapa alasan sebagai berikut :</p><ol><li>Tembaga merupakan jenis konduktor yang baik dengan tingkat hambatan yang relatif kecil</li><li>Lebih ekonomis dibandingkan bahan yang lain, misalnya perak.</li><li>Mudah melebur, menyerap, dan melepas panas, sehingga mudah dideteksi saat terjadi kerusakan.</li><li>Memiliki kelenturan yang baik, sehingga mudah dipasangkan dalam jaringan atau instalasi listrik.</li><li>Memiliki massa jenis yang cukup kecil, memiliki bobot yang cukup ringan</li></ol>

Tembaga banyak digunakan sebagai kabel listrik karena beberapa alasan sebagai berikut :

  1. Tembaga merupakan jenis konduktor yang baik dengan tingkat hambatan yang relatif kecil
  2. Lebih ekonomis dibandingkan bahan yang lain, misalnya perak.
  3. Mudah melebur, menyerap, dan melepas panas, sehingga mudah dideteksi saat terjadi kerusakan.
  4. Memiliki kelenturan yang baik, sehingga mudah dipasangkan dalam jaringan atau instalasi listrik.
  5. Memiliki massa jenis yang cukup kecil, memiliki bobot yang cukup ringan

lock

Yah, akses pembahasan gratismu habis


atau

Dapatkan jawaban pertanyaanmu di AiRIS. Langsung dijawab oleh bestie pintar

Tanya Sekarang

Mau pemahaman lebih dalam untuk soal ini?

Tanya ke Forum

Biar Robosquad lain yang jawab soal kamu

Tanya ke Forum

LATIHAN SOAL GRATIS!

Drill Soal

Latihan soal sesuai topik yang kamu mau untuk persiapan ujian

Cobain Drill Soal

Perdalam pemahamanmu bersama Master Teacher
di sesi Live Teaching, GRATIS!

Pertanyaan serupa

1. Jelaskanpenggunaam metode metagenom dapat dimanfaatkan untuk menemukan produk-produk bioteknologi yang bermanfaat pada bidang farmasi. Uraikan jawaban anda dengan menjelaskan definisi, contoh produk dan teknik pembuatan produk 2. Pemerintah Indonesia menggunakan 3 metode untuk mendeteksi keberadaan SARS-cov2,yaitu tes cepat antibodi, tes cepat molekuler, dan real time PCR. a.Jelaskan perbedaan prinsip kerja ketiga cara tersebut! b.Jelaskan tahap-tahap real time PCR, gen target, urutan primer yang digunakan, siklusamplifikasi. Tuliskan sumber referensi yang anda gunakan 3. Sebutkan urutan asam amino hasil translasi yang dikode oleh “DNA templat” berikut ini:3’ atttacgatagtttcgatagacaaaagtcaattcgtttcgaattatcaattgccgcatcactt 5’ 4.Berikan salah satu jurnal penelitian pembuatan DNA rekombinan pada bidang farmasi,kemudian: a.Gambarkan plasmid yang digunakan sebagai vektor pembuatan DNA rekombinan! b.Jelaskan arti dan fungsi setiap notasi dalam gambar!

4

0.0

Jawaban terverifikasi