Atikah R

19 Februari 2024 00:22

Iklan

Iklan

Atikah R

19 Februari 2024 00:22

Pertanyaan

Mengapa terjadi perbedaan kadar kandungan protein plasma dan glukosa, baik dalam darah maupun dalam urine?

Mengapa terjadi perbedaan kadar kandungan protein plasma dan glukosa, baik dalam darah maupun dalam urine?


5

1

Jawaban terverifikasi

Iklan

Iklan

S. Agita

Mahasiswa/Alumni Politeknik Negeri Jember

19 Februari 2024 12:05

Jawaban terverifikasi

Jawaban yang benar akan dijelaskan pada pembahasan berikut ini. Pembahasan: Perbedaan kadar kandungan protein plasma dan glukosa dalam darah dan urine terjadi karena fungsi dan proses yang berbeda dalam tubuh. 1. Protein: - Kadar protein dalam plasma biasanya diatur oleh faktor-faktor, seperti asupan protein, sintesis protein dalam tubuh, dan fungsi organ seperti hati dan ginjal dalam mengatur keseimbangan protein. - Protein plasma yang terlalu tinggi bisa menandakan masalah, seperti infeksi, inflamasi, atau gangguan ginjal. - Kadar protein dalam urine biasanya rendah karena ginjal seharusnya mempertahankan protein-protein penting dalam darah tetapi dapat meningkat dalam kondisi, seperti kerusakan ginjal atau gangguan filtrasi glomerulus. 2. Glukosa: - Kadar glukosa dalam darah diatur oleh hormon insulin dan glukagon untuk memastikan tubuh mendapatkan energi yang cukup. - Kadar glukosa darah yang tinggi (hiperglikemia) bisa menandakan diabetes atau masalah metabolik lainnya. - Kadar glukosa dalam urine biasanya rendah karena ginjal seharusnya menyerap kembali glukosa yang difiltrasi tetapi dapat meningkat dalam kondisi, seperti diabetes yang tidak terkontrol di mana ginjal tidak dapat menyerap kembali semua glukosa. Jadi, perbedaan dalam kadar protein dan glukosa dalam plasma dan urine tercermin dari fungsi dan regulasi tubuh yang berbeda terhadap kedua zat tersebut.


Iklan

Iklan

lock

Yah, akses pembahasan gratismu habis


atau

Dapatkan jawaban pertanyaanmu di AiRIS. Langsung dijawab oleh bestie pintar

Tanya Sekarang

Mau pemahaman lebih dalam untuk soal ini?

Tanya ke Forum

Biar Robosquad lain yang jawab soal kamu

Tanya ke Forum

LATIHAN SOAL GRATIS!

Drill Soal

Latihan soal sesuai topik yang kamu mau untuk persiapan ujian

Cobain Drill Soal

Perdalam pemahamanmu bersama Master Teacher
di sesi Live Teaching, GRATIS!

Pertanyaan serupa

1. Jelaskanpenggunaam metode metagenom dapat dimanfaatkan untuk menemukan produk-produk bioteknologi yang bermanfaat pada bidang farmasi. Uraikan jawaban anda dengan menjelaskan definisi, contoh produk dan teknik pembuatan produk 2. Pemerintah Indonesia menggunakan 3 metode untuk mendeteksi keberadaan SARS-cov2,yaitu tes cepat antibodi, tes cepat molekuler, dan real time PCR. a.Jelaskan perbedaan prinsip kerja ketiga cara tersebut! b.Jelaskan tahap-tahap real time PCR, gen target, urutan primer yang digunakan, siklusamplifikasi. Tuliskan sumber referensi yang anda gunakan 3. Sebutkan urutan asam amino hasil translasi yang dikode oleh “DNA templat” berikut ini:3’ atttacgatagtttcgatagacaaaagtcaattcgtttcgaattatcaattgccgcatcactt 5’ 4.Berikan salah satu jurnal penelitian pembuatan DNA rekombinan pada bidang farmasi,kemudian: a.Gambarkan plasmid yang digunakan sebagai vektor pembuatan DNA rekombinan! b.Jelaskan arti dan fungsi setiap notasi dalam gambar!

4

0.0

Jawaban terverifikasi