Salsa S

10 Maret 2024 09:42

Iklan

Iklan

Salsa S

10 Maret 2024 09:42

Pertanyaan

Konduksi merupakan proses perpindahan kalor yang tanpa disertai perpindahan partikel, biasanya terjadi pada pipa logam. Banyaknya kalor yang berpindah tiap sekon pada suatu pipa besi adalah.... 1. Sebanding dengan perbedaan suhu antara kedua ujung pipa 2. Berbanding terbalik dengan luas penampang pipa 3. Sebanding dengan kofisien konduksi 4. Sebanding dengan panjang pipa Pernyataan yang benar: A. 1 dan 2 B. 1 dan 3. C. 2 dan 4 D. 1 dan 4 E. 3 dan 4

Konduksi merupakan proses perpindahan kalor yang tanpa disertai perpindahan partikel, biasanya terjadi pada pipa logam. Banyaknya kalor yang berpindah tiap sekon pada suatu pipa besi adalah....

1. Sebanding dengan perbedaan suhu antara kedua ujung pipa 

2. Berbanding terbalik dengan luas penampang pipa

3. Sebanding dengan kofisien konduksi

4. Sebanding dengan panjang pipa 

Pernyataan yang benar:

A. 1 dan 2

B. 1 dan 3.

C. 2 dan 4

D. 1 dan 4

E. 3 dan 4


1

1

Jawaban terverifikasi

Iklan

Iklan

Y. Frando

11 Maret 2024 05:49

Jawaban terverifikasi

<p>Jawaban yang benar adalah B. 1 dan 3.</p><p>&nbsp;</p><p>Pembahasan:</p><p>Konduksi adalah proses perpindahan kalor yang terjadi pada suatu zat tanpa disertai perpindahan partikel-partikel dari zat tersebut. Konduksi umumnya terjadi pada zat padat terutama yang bersifat konduktor. Persamaan yang berlaku pada konduksi adalah:</p><p>&nbsp;</p><p>P = Q/t = k × A × ΔT / L,</p><p>&nbsp;</p><p>dengan:</p><p>P = daya (W)</p><p>Q = kalor (J)</p><p>t = waktu (s)</p><p>k = konduktivitas termal (Js.m°C)</p><p>A = luas penampang (m²)</p><p>ΔT = beda suhu (°C)</p><p>L = tebal atau panjang bahan (m).</p><p>&nbsp;</p><p>Berdasarkan penjelasan di atas, maka banyaknya kalor yang berpindah tiap sekon pada suatu pipa besi adalah:</p><p>1. Sebanding dengan perbedaan suhu antara kedua ujung pipa (P ~ ΔT) ----&gt; BENAR</p><p>2. Berbanding terbalik dengan luas penampang pipa (P ~ A) ----&gt; SALAH</p><p>3. Sebanding dengan koefisien konduksi (P ~ k) ----&gt; BENAR</p><p>4. Sebanding dengan panjang pipa (P ~ 1/L) ----&gt; SALAH</p><p>&nbsp;</p><p>Oleh karena itu, jawaban yang benar adalah B.</p>

Jawaban yang benar adalah B. 1 dan 3.

 

Pembahasan:

Konduksi adalah proses perpindahan kalor yang terjadi pada suatu zat tanpa disertai perpindahan partikel-partikel dari zat tersebut. Konduksi umumnya terjadi pada zat padat terutama yang bersifat konduktor. Persamaan yang berlaku pada konduksi adalah:

 

P = Q/t = k × A × ΔT / L,

 

dengan:

P = daya (W)

Q = kalor (J)

t = waktu (s)

k = konduktivitas termal (Js.m°C)

A = luas penampang (m²)

ΔT = beda suhu (°C)

L = tebal atau panjang bahan (m).

 

Berdasarkan penjelasan di atas, maka banyaknya kalor yang berpindah tiap sekon pada suatu pipa besi adalah:

1. Sebanding dengan perbedaan suhu antara kedua ujung pipa (P ~ ΔT) ----> BENAR

2. Berbanding terbalik dengan luas penampang pipa (P ~ A) ----> SALAH

3. Sebanding dengan koefisien konduksi (P ~ k) ----> BENAR

4. Sebanding dengan panjang pipa (P ~ 1/L) ----> SALAH

 

Oleh karena itu, jawaban yang benar adalah B.


Iklan

Iklan

lock

Yah, akses pembahasan gratismu habis


atau

Dapatkan jawaban pertanyaanmu di AiRIS. Langsung dijawab oleh bestie pintar

Tanya Sekarang

Mau pemahaman lebih dalam untuk soal ini?

Tanya ke Forum

Biar Robosquad lain yang jawab soal kamu

Tanya ke Forum

LATIHAN SOAL GRATIS!

Drill Soal

Latihan soal sesuai topik yang kamu mau untuk persiapan ujian

Cobain Drill Soal

Perdalam pemahamanmu bersama Master Teacher
di sesi Live Teaching, GRATIS!

Pertanyaan serupa

1. Jelaskanpenggunaam metode metagenom dapat dimanfaatkan untuk menemukan produk-produk bioteknologi yang bermanfaat pada bidang farmasi. Uraikan jawaban anda dengan menjelaskan definisi, contoh produk dan teknik pembuatan produk 2. Pemerintah Indonesia menggunakan 3 metode untuk mendeteksi keberadaan SARS-cov2,yaitu tes cepat antibodi, tes cepat molekuler, dan real time PCR. a.Jelaskan perbedaan prinsip kerja ketiga cara tersebut! b.Jelaskan tahap-tahap real time PCR, gen target, urutan primer yang digunakan, siklusamplifikasi. Tuliskan sumber referensi yang anda gunakan 3. Sebutkan urutan asam amino hasil translasi yang dikode oleh “DNA templat” berikut ini:3’ atttacgatagtttcgatagacaaaagtcaattcgtttcgaattatcaattgccgcatcactt 5’ 4.Berikan salah satu jurnal penelitian pembuatan DNA rekombinan pada bidang farmasi,kemudian: a.Gambarkan plasmid yang digunakan sebagai vektor pembuatan DNA rekombinan! b.Jelaskan arti dan fungsi setiap notasi dalam gambar!

4

0.0

Jawaban terverifikasi