Jus A

29 Februari 2024 05:27

Iklan

Iklan

Jus A

29 Februari 2024 05:27

Pertanyaan

jelaskan 3 sumber daya alam tambang

jelaskan 3 sumber daya alam tambang


4

2


Iklan

Iklan

Kevin L

Bronze

29 Februari 2024 13:32

Sumber daya alam tambang adalah bahan-bahan yang diekstraksi dari bumi melalui proses pertambangan. Berikut adalah tiga contoh sumber daya alam tambang: 1. **Besi**: Bijih besi adalah salah satu sumber daya alam tambang yang penting. Besi digunakan dalam berbagai industri termasuk pembuatan baja, konstruksi, dan manufaktur. Proses pertambangan bijih besi melibatkan ekstraksi batuan yang mengandung konsentrasi tinggi besi, yang kemudian diolah menjadi produk-produk besi dan baja. 2. **Batubara**: Batubara adalah sumber daya alam tambang yang penting dalam industri energi. Ini adalah salah satu bahan bakar fosil yang paling banyak digunakan di dunia untuk menghasilkan listrik dan panas. Proses pertambangan batubara melibatkan ekstraksi lapisan batuan yang mengandung batubara, yang kemudian diolah menjadi berbagai ukuran dan kualitas untuk berbagai keperluan. 3. **Emas**: Emas adalah logam berharga yang telah digunakan selama ribuan tahun untuk perhiasan, investasi, dan aplikasi industri. Pertambangan emas melibatkan ekstraksi bijih emas dari tanah atau batuan yang mengandung konsentrasi emas yang ekonomis. Proses ini sering melibatkan penggunaan teknologi canggih dan metode penambangan yang berbeda, tergantung pada karakteristik geologis dan ekonomis dari deposit emas tersebut.


Iklan

Iklan

Helmi F

06 Maret 2024 13:21

<p>Sumber daya alam tambang merupakan sumber daya alam yang diekstrak dari bagian dalam bumi berikut contohnya</p><p>-besi</p><p>-batubara</p><p>-emas</p><p>&nbsp;</p>

Sumber daya alam tambang merupakan sumber daya alam yang diekstrak dari bagian dalam bumi berikut contohnya

-besi

-batubara

-emas

 


Mau jawaban yang terverifikasi?

Tanya ke Forum

Biar Robosquad lain yang jawab soal kamu

Tanya ke Forum

LATIHAN SOAL GRATIS!

Drill Soal

Latihan soal sesuai topik yang kamu mau untuk persiapan ujian

Cobain Drill Soal

Perdalam pemahamanmu bersama Master Teacher
di sesi Live Teaching, GRATIS!

Pertanyaan serupa

1. Jelaskanpenggunaam metode metagenom dapat dimanfaatkan untuk menemukan produk-produk bioteknologi yang bermanfaat pada bidang farmasi. Uraikan jawaban anda dengan menjelaskan definisi, contoh produk dan teknik pembuatan produk 2. Pemerintah Indonesia menggunakan 3 metode untuk mendeteksi keberadaan SARS-cov2,yaitu tes cepat antibodi, tes cepat molekuler, dan real time PCR. a.Jelaskan perbedaan prinsip kerja ketiga cara tersebut! b.Jelaskan tahap-tahap real time PCR, gen target, urutan primer yang digunakan, siklusamplifikasi. Tuliskan sumber referensi yang anda gunakan 3. Sebutkan urutan asam amino hasil translasi yang dikode oleh “DNA templat” berikut ini:3’ atttacgatagtttcgatagacaaaagtcaattcgtttcgaattatcaattgccgcatcactt 5’ 4.Berikan salah satu jurnal penelitian pembuatan DNA rekombinan pada bidang farmasi,kemudian: a.Gambarkan plasmid yang digunakan sebagai vektor pembuatan DNA rekombinan! b.Jelaskan arti dan fungsi setiap notasi dalam gambar!

2

0.0

Jawaban terverifikasi