Wasil K

19 Maret 2024 05:07

Iklan

Iklan

Wasil K

19 Maret 2024 05:07

Pertanyaan

didalam tubuh hiterotrof, produktivitas primer bersih ,sebab sebagian akan hilang dalam bentuk egesta,ekskreta dan energi pernafasan jelaskan !

didalam tubuh hiterotrof, produktivitas primer bersih ,sebab sebagian akan hilang dalam bentuk egesta,ekskreta dan energi pernafasan jelaskan !


6

1

Jawaban terverifikasi

Iklan

Iklan

Salsabila M

Community

19 Maret 2024 08:21

Jawaban terverifikasi

<p><br>Dalam tubuh heterotrof, produktivitas primer bersih mengacu pada jumlah energi yang tersedia untuk konsumen di tingkat trofik tertentu setelah dikurangi oleh sejumlah kegiatan metabolik dan pengeluaran energi yang tidak langsung terkait dengan pertumbuhan atau reproduksi. Sebagian energi yang diproduksi oleh produsen dalam rantai makanan akan hilang dalam beberapa bentuk, yaitu egesta (sisa-sisa yang tidak dicerna dari makanan), ekskreta (limbah yang dihasilkan oleh proses metabolisme), dan energi yang digunakan dalam pernafasan.</p><p><strong>Egesta</strong>: Ketika hewan makan, tidak semua bagian makanan dapat dicerna sepenuhnya. Sisa-sisa makanan yang tidak dicerna akan dikeluarkan sebagai egesta. Meskipun energi telah digunakan untuk mencerna makanan, bagian yang tidak dapat dicerna masih mengandung sejumlah energi yang tersisa, tetapi tidak tersedia untuk konsumen. Sebagian energi dari produk primer akan hilang dalam bentuk egesta ini.</p><p><strong>Ekskreta</strong>: Proses metabolisme dalam tubuh hewan menghasilkan limbah yang perlu dikeluarkan dari tubuh. Limbah ini termasuk dalam bentuk ekskreta seperti urine, feces, dan lain-lain. Meskipun limbah ini mengandung sejumlah kecil energi, energi ini tidak tersedia untuk digunakan oleh konsumen.</p><p><strong>Energi Pernafasan</strong>: Bagian lain dari energi primer yang hilang adalah yang digunakan dalam proses pernafasan. Organisme heterotrof menggunakan oksigen untuk membakar makanan yang mereka konsumsi, menghasilkan energi yang digunakan untuk menjalankan berbagai fungsi tubuh. Namun, tidak semua energi yang dihasilkan dari makanan tersebut akan disimpan sebagai energi kimia dalam tubuh; sebagian besar akan digunakan dalam proses metabolisme dan kegiatan sehari-hari organisme. Oleh karena itu, sebagian energi primer hilang dalam bentuk energi pernafasan.</p><p><br>&nbsp;</p>


Dalam tubuh heterotrof, produktivitas primer bersih mengacu pada jumlah energi yang tersedia untuk konsumen di tingkat trofik tertentu setelah dikurangi oleh sejumlah kegiatan metabolik dan pengeluaran energi yang tidak langsung terkait dengan pertumbuhan atau reproduksi. Sebagian energi yang diproduksi oleh produsen dalam rantai makanan akan hilang dalam beberapa bentuk, yaitu egesta (sisa-sisa yang tidak dicerna dari makanan), ekskreta (limbah yang dihasilkan oleh proses metabolisme), dan energi yang digunakan dalam pernafasan.

Egesta: Ketika hewan makan, tidak semua bagian makanan dapat dicerna sepenuhnya. Sisa-sisa makanan yang tidak dicerna akan dikeluarkan sebagai egesta. Meskipun energi telah digunakan untuk mencerna makanan, bagian yang tidak dapat dicerna masih mengandung sejumlah energi yang tersisa, tetapi tidak tersedia untuk konsumen. Sebagian energi dari produk primer akan hilang dalam bentuk egesta ini.

Ekskreta: Proses metabolisme dalam tubuh hewan menghasilkan limbah yang perlu dikeluarkan dari tubuh. Limbah ini termasuk dalam bentuk ekskreta seperti urine, feces, dan lain-lain. Meskipun limbah ini mengandung sejumlah kecil energi, energi ini tidak tersedia untuk digunakan oleh konsumen.

Energi Pernafasan: Bagian lain dari energi primer yang hilang adalah yang digunakan dalam proses pernafasan. Organisme heterotrof menggunakan oksigen untuk membakar makanan yang mereka konsumsi, menghasilkan energi yang digunakan untuk menjalankan berbagai fungsi tubuh. Namun, tidak semua energi yang dihasilkan dari makanan tersebut akan disimpan sebagai energi kimia dalam tubuh; sebagian besar akan digunakan dalam proses metabolisme dan kegiatan sehari-hari organisme. Oleh karena itu, sebagian energi primer hilang dalam bentuk energi pernafasan.


 


Iklan

Iklan

lock

Yah, akses pembahasan gratismu habis


atau

Dapatkan jawaban pertanyaanmu di AiRIS. Langsung dijawab oleh bestie pintar

Tanya Sekarang

Mau pemahaman lebih dalam untuk soal ini?

Tanya ke Forum

Biar Robosquad lain yang jawab soal kamu

Tanya ke Forum

LATIHAN SOAL GRATIS!

Drill Soal

Latihan soal sesuai topik yang kamu mau untuk persiapan ujian

Cobain Drill Soal

Perdalam pemahamanmu bersama Master Teacher
di sesi Live Teaching, GRATIS!

Pertanyaan serupa

1. Jelaskanpenggunaam metode metagenom dapat dimanfaatkan untuk menemukan produk-produk bioteknologi yang bermanfaat pada bidang farmasi. Uraikan jawaban anda dengan menjelaskan definisi, contoh produk dan teknik pembuatan produk 2. Pemerintah Indonesia menggunakan 3 metode untuk mendeteksi keberadaan SARS-cov2,yaitu tes cepat antibodi, tes cepat molekuler, dan real time PCR. a.Jelaskan perbedaan prinsip kerja ketiga cara tersebut! b.Jelaskan tahap-tahap real time PCR, gen target, urutan primer yang digunakan, siklusamplifikasi. Tuliskan sumber referensi yang anda gunakan 3. Sebutkan urutan asam amino hasil translasi yang dikode oleh “DNA templat” berikut ini:3’ atttacgatagtttcgatagacaaaagtcaattcgtttcgaattatcaattgccgcatcactt 5’ 4.Berikan salah satu jurnal penelitian pembuatan DNA rekombinan pada bidang farmasi,kemudian: a.Gambarkan plasmid yang digunakan sebagai vektor pembuatan DNA rekombinan! b.Jelaskan arti dan fungsi setiap notasi dalam gambar!

4

0.0

Jawaban terverifikasi