WARZUQNI N

21 Februari 2024 01:16

Iklan

Iklan

WARZUQNI N

21 Februari 2024 01:16

Pertanyaan

Berikan 5 contoh ragam gerak tari

Berikan 5 contoh ragam gerak tari


3

1

Jawaban terverifikasi

Iklan

Iklan

Nanda R

Gold

22 Februari 2024 14:41

Jawaban terverifikasi

<p>Ragam gerak tari mencakup berbagai bentuk gerakan yang mencerminkan karakteristik budaya, gaya, dan tema tertentu. Berikut adalah lima contoh ragam gerak tari dari berbagai tradisi tari di seluruh dunia:</p><p><strong>Tari Klasik India (Bharatanatyam):</strong></p><ul><li>Bharatanatyam adalah bentuk tari klasik India yang mengandung gerakan-gerakan yang anggun dan kompleks. Gerakan kaki, tangan, dan kepala memiliki pola yang terstruktur dan memiliki makna simbolis. Tari ini biasanya dipentaskan dengan iringan musik klasik India.</li></ul><p><strong>Tari Bali (Tari Legong):</strong></p><ul><li>Tari Legong adalah tarian tradisional Bali yang mengutamakan gerakan tangan dan mata yang halus. Gerakan yang elegan dan penuh ekspresi memperlihatkan keanggunan dan kecantikan, sering kali ditarikan oleh penari muda.</li></ul><p><strong>Tari Flamenco Spanyol:</strong></p><ul><li>Tari Flamenco berasal dari Spanyol dan mencakup gerakan yang penuh gairah dan ekspresif. Penari Flamenco menggunakan kaki dan tangan dengan teknik ketukan kaki yang khas. Tarian ini mencerminkan kekuatan dan emosi yang mendalam.</li></ul><p><strong>Tari Hula Hawaii:</strong></p><ul><li>Tari Hula adalah tarian tradisional Hawaii yang menggabungkan gerakan tangan, mata, dan kaki. Gerakan-gerakan ini bervariasi, termasuk gerakan halus yang menggambarkan keindahan alam, serta gerakan yang lebih energik untuk mencerminkan kejadian bersemangat.</li></ul><p><strong>Tari Tap Amerika:</strong></p><ul><li>Tari Tap melibatkan penggunaan sepatu khusus yang dilengkapi tap di bagian bawahnya. Dengan mengetukkan kaki ke lantai, penari menciptakan ritme dan suara yang khas. Gerakan tari ini sering kali dinamis dan memerlukan koordinasi yang baik.</li></ul>

Ragam gerak tari mencakup berbagai bentuk gerakan yang mencerminkan karakteristik budaya, gaya, dan tema tertentu. Berikut adalah lima contoh ragam gerak tari dari berbagai tradisi tari di seluruh dunia:

Tari Klasik India (Bharatanatyam):

  • Bharatanatyam adalah bentuk tari klasik India yang mengandung gerakan-gerakan yang anggun dan kompleks. Gerakan kaki, tangan, dan kepala memiliki pola yang terstruktur dan memiliki makna simbolis. Tari ini biasanya dipentaskan dengan iringan musik klasik India.

Tari Bali (Tari Legong):

  • Tari Legong adalah tarian tradisional Bali yang mengutamakan gerakan tangan dan mata yang halus. Gerakan yang elegan dan penuh ekspresi memperlihatkan keanggunan dan kecantikan, sering kali ditarikan oleh penari muda.

Tari Flamenco Spanyol:

  • Tari Flamenco berasal dari Spanyol dan mencakup gerakan yang penuh gairah dan ekspresif. Penari Flamenco menggunakan kaki dan tangan dengan teknik ketukan kaki yang khas. Tarian ini mencerminkan kekuatan dan emosi yang mendalam.

Tari Hula Hawaii:

  • Tari Hula adalah tarian tradisional Hawaii yang menggabungkan gerakan tangan, mata, dan kaki. Gerakan-gerakan ini bervariasi, termasuk gerakan halus yang menggambarkan keindahan alam, serta gerakan yang lebih energik untuk mencerminkan kejadian bersemangat.

Tari Tap Amerika:

  • Tari Tap melibatkan penggunaan sepatu khusus yang dilengkapi tap di bagian bawahnya. Dengan mengetukkan kaki ke lantai, penari menciptakan ritme dan suara yang khas. Gerakan tari ini sering kali dinamis dan memerlukan koordinasi yang baik.

Iklan

Iklan

lock

Yah, akses pembahasan gratismu habis


atau

Dapatkan jawaban pertanyaanmu di AiRIS. Langsung dijawab oleh bestie pintar

Tanya Sekarang

Mau pemahaman lebih dalam untuk soal ini?

Tanya ke Forum

Biar Robosquad lain yang jawab soal kamu

Tanya ke Forum

LATIHAN SOAL GRATIS!

Drill Soal

Latihan soal sesuai topik yang kamu mau untuk persiapan ujian

Cobain Drill Soal

Perdalam pemahamanmu bersama Master Teacher
di sesi Live Teaching, GRATIS!

Pertanyaan serupa

1. Jelaskanpenggunaam metode metagenom dapat dimanfaatkan untuk menemukan produk-produk bioteknologi yang bermanfaat pada bidang farmasi. Uraikan jawaban anda dengan menjelaskan definisi, contoh produk dan teknik pembuatan produk 2. Pemerintah Indonesia menggunakan 3 metode untuk mendeteksi keberadaan SARS-cov2,yaitu tes cepat antibodi, tes cepat molekuler, dan real time PCR. a.Jelaskan perbedaan prinsip kerja ketiga cara tersebut! b.Jelaskan tahap-tahap real time PCR, gen target, urutan primer yang digunakan, siklusamplifikasi. Tuliskan sumber referensi yang anda gunakan 3. Sebutkan urutan asam amino hasil translasi yang dikode oleh “DNA templat” berikut ini:3’ atttacgatagtttcgatagacaaaagtcaattcgtttcgaattatcaattgccgcatcactt 5’ 4.Berikan salah satu jurnal penelitian pembuatan DNA rekombinan pada bidang farmasi,kemudian: a.Gambarkan plasmid yang digunakan sebagai vektor pembuatan DNA rekombinan! b.Jelaskan arti dan fungsi setiap notasi dalam gambar!

4

0.0

Jawaban terverifikasi