Ranxyz R

13 Maret 2024 15:49

Iklan

Iklan

Ranxyz R

13 Maret 2024 15:49

Pertanyaan

1.Perhatikan pernyataan berikut! (1) mengembalikan pelaku penyimpangan ke dalam koridor norma yang berlaku (2) mengatur perilaku masyarakat sesuai dengan nilai dan norma yang berlaku (3) menghimpun nilai dan norma yang berlaku dalam masyarakat (4) menciptakan kondisi serasi dan seimbang sesuai dengan system norma yang berlaku (5) menciptakan ketertiban dalam masyarakat. Dari pernyataan berikut, yang dapat digolongkan sebagai tujuan pengendalian sosial adalah A 1, 2 dan 3 B 1, 4 dan 5 C 2, 3 dan 4 D 2, 4 dan 5 E 3, 4 dan 5

1.Perhatikan pernyataan berikut!

(1) mengembalikan pelaku penyimpangan ke dalam koridor norma yang berlaku

(2) mengatur perilaku masyarakat sesuai dengan nilai dan norma yang berlaku

(3) menghimpun nilai dan norma yang berlaku dalam masyarakat

(4) menciptakan kondisi serasi dan seimbang sesuai dengan system norma yang berlaku

(5) menciptakan ketertiban dalam masyarakat.

Dari pernyataan berikut, yang dapat digolongkan sebagai tujuan pengendalian sosial adalah

A 1, 2 dan 3

B 1, 4 dan 5

C 2, 3 dan 4

D 2, 4 dan 5

E 3, 4 dan 5


8

2

Jawaban terverifikasi

Iklan

Iklan

Salsabila M

Community

14 Maret 2024 00:51

Jawaban terverifikasi

<p><br>Tujuan pengendalian sosial adalah untuk mengatur perilaku masyarakat sesuai dengan nilai dan norma yang berlaku serta menciptakan ketertiban dalam masyarakat. Oleh karena itu, pernyataan yang dapat digolongkan sebagai tujuan pengendalian sosial adalah:</p><p>D. 2, 4 dan 5</p><p>&nbsp;</p><p>berikut penjelasan mengapa pernyataan 2, 4, dan 5 dapat digolongkan sebagai tujuan pengendalian sosial:</p><p>"Mengatur perilaku masyarakat sesuai dengan nilai dan norma yang berlaku": Pengendalian sosial bertujuan untuk mengarahkan perilaku individu atau kelompok dalam masyarakat agar sesuai dengan nilai-nilai, norma, dan aturan yang diterima secara luas dalam masyarakat. Dengan mengatur perilaku sesuai dengan nilai dan norma yang berlaku, pengendalian sosial dapat memastikan stabilitas dan kohesi sosial.</p><p>"Menciptakan kondisi serasi dan seimbang sesuai dengan sistem norma yang berlaku": Pengendalian sosial juga bertujuan untuk menciptakan keseimbangan dan harmoni dalam masyarakat dengan memastikan bahwa perilaku individu atau kelompok tidak melanggar sistem norma yang berlaku. Dengan menciptakan kondisi yang serasi dan seimbang, pengendalian sosial membantu menjaga stabilitas sosial dan mengurangi konflik.</p><p>"Menciptakan ketertiban dalam masyarakat": Salah satu tujuan utama pengendalian sosial adalah untuk menciptakan dan memelihara ketertiban dalam masyarakat. Dengan memastikan bahwa individu dan kelompok mengikuti nilai, norma, dan aturan yang berlaku, pengendalian sosial membantu mencegah terjadinya kerusuhan, konflik, atau kekacauan dalam masyarakat.</p><p>Dengan demikian, pernyataan 2, 4, dan 5 merupakan tujuan-tujuan yang sesuai dengan konsep pengendalian sosial.</p>


Tujuan pengendalian sosial adalah untuk mengatur perilaku masyarakat sesuai dengan nilai dan norma yang berlaku serta menciptakan ketertiban dalam masyarakat. Oleh karena itu, pernyataan yang dapat digolongkan sebagai tujuan pengendalian sosial adalah:

D. 2, 4 dan 5

 

berikut penjelasan mengapa pernyataan 2, 4, dan 5 dapat digolongkan sebagai tujuan pengendalian sosial:

"Mengatur perilaku masyarakat sesuai dengan nilai dan norma yang berlaku": Pengendalian sosial bertujuan untuk mengarahkan perilaku individu atau kelompok dalam masyarakat agar sesuai dengan nilai-nilai, norma, dan aturan yang diterima secara luas dalam masyarakat. Dengan mengatur perilaku sesuai dengan nilai dan norma yang berlaku, pengendalian sosial dapat memastikan stabilitas dan kohesi sosial.

"Menciptakan kondisi serasi dan seimbang sesuai dengan sistem norma yang berlaku": Pengendalian sosial juga bertujuan untuk menciptakan keseimbangan dan harmoni dalam masyarakat dengan memastikan bahwa perilaku individu atau kelompok tidak melanggar sistem norma yang berlaku. Dengan menciptakan kondisi yang serasi dan seimbang, pengendalian sosial membantu menjaga stabilitas sosial dan mengurangi konflik.

"Menciptakan ketertiban dalam masyarakat": Salah satu tujuan utama pengendalian sosial adalah untuk menciptakan dan memelihara ketertiban dalam masyarakat. Dengan memastikan bahwa individu dan kelompok mengikuti nilai, norma, dan aturan yang berlaku, pengendalian sosial membantu mencegah terjadinya kerusuhan, konflik, atau kekacauan dalam masyarakat.

Dengan demikian, pernyataan 2, 4, dan 5 merupakan tujuan-tujuan yang sesuai dengan konsep pengendalian sosial.


Iklan

Iklan

Habil D

14 Maret 2024 16:12

<p>B</p>

B


lock

Yah, akses pembahasan gratismu habis


atau

Dapatkan jawaban pertanyaanmu di AiRIS. Langsung dijawab oleh bestie pintar

Tanya Sekarang

Mau pemahaman lebih dalam untuk soal ini?

Tanya ke Forum

Biar Robosquad lain yang jawab soal kamu

Tanya ke Forum

LATIHAN SOAL GRATIS!

Drill Soal

Latihan soal sesuai topik yang kamu mau untuk persiapan ujian

Cobain Drill Soal

Perdalam pemahamanmu bersama Master Teacher
di sesi Live Teaching, GRATIS!

Pertanyaan serupa

1. Jelaskanpenggunaam metode metagenom dapat dimanfaatkan untuk menemukan produk-produk bioteknologi yang bermanfaat pada bidang farmasi. Uraikan jawaban anda dengan menjelaskan definisi, contoh produk dan teknik pembuatan produk 2. Pemerintah Indonesia menggunakan 3 metode untuk mendeteksi keberadaan SARS-cov2,yaitu tes cepat antibodi, tes cepat molekuler, dan real time PCR. a.Jelaskan perbedaan prinsip kerja ketiga cara tersebut! b.Jelaskan tahap-tahap real time PCR, gen target, urutan primer yang digunakan, siklusamplifikasi. Tuliskan sumber referensi yang anda gunakan 3. Sebutkan urutan asam amino hasil translasi yang dikode oleh “DNA templat” berikut ini:3’ atttacgatagtttcgatagacaaaagtcaattcgtttcgaattatcaattgccgcatcactt 5’ 4.Berikan salah satu jurnal penelitian pembuatan DNA rekombinan pada bidang farmasi,kemudian: a.Gambarkan plasmid yang digunakan sebagai vektor pembuatan DNA rekombinan! b.Jelaskan arti dan fungsi setiap notasi dalam gambar!

4

0.0

Jawaban terverifikasi